Mutagenetix > Incidental Mutations

Incidental Mutation 'R7743:Agbl3'

596649

Institutional Source

Beutler Lab

Gene Symbol

Agbl3

Ensembl Gene

ENSMUSG00000038836

Gene Name

ATP/GTP binding protein-like 3

Synonyms

4930431N21Rik, 2900053G10Rik, 6530406M24Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7743 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

34780432-34859459 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 34846830 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 815 (T815I)

Ref Sequence

ENSEMBL: ENSMUSP00000110668 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000115016] [ENSMUST00000115017] [ENSMUST00000148834]

AlphaFold

Q8CDP0

Predicted Effect

probably damaging
Transcript: ENSMUST00000115016
AA Change: T815I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000110668
Gene: ENSMUSG00000038836
AA Change: T815I

Domain	Start	End	E-Value	Type
low complexity region	2	25	N/A	INTRINSIC
Pfam:Peptidase_M14	314	563	2.7e-19	PFAM
low complexity region	614	629	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000115017
AA Change: T810I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000110669
Gene: ENSMUSG00000038836
AA Change: T810I

Domain	Start	End	E-Value	Type
low complexity region	2	25	N/A	INTRINSIC
Pfam:Peptidase_M14	309	560	1e-33	PFAM
low complexity region	609	624	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000148834

SMART Domains

Protein: ENSMUSP00000116066
Gene: ENSMUSG00000038836

Domain	Start	End	E-Value	Type
low complexity region	2	25	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

97% (77/79)

MGI Phenotype

PHENOTYPE: Homozygous mice for a targeted allele are viable and fertile. Mice homozygous for a knock-out allele exhibit normal response to herpes simplex virus (HSV) and vaccinia virus (VACV) infection. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 83 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	A	G	3: 138,068,755	E1235G	probably damaging	Het
Adam6a	A	G	12: 113,544,532	D175G	probably benign	Het
Adgrf4	A	T	17: 42,672,562	C76*	probably null	Het
Ahnak2	A	G	12: 112,784,763	V488A	not run	Het
Akip1	T	A	7: 109,711,828	S192T	probably benign	Het
Apc2	G	A	10: 80,304,915	M201I	probably damaging	Het
Arel1	G	T	12: 84,940,269	N124K	probably damaging	Het
Atp10a	A	T	7: 58,803,709	H845L	probably damaging	Het
Atp2a2	A	G	5: 122,461,571	Y586H	probably benign	Het
BC051019	A	G	7: 109,716,059	Y330H	probably damaging	Het
Btbd11	A	T	10: 85,624,949	I569F	possibly damaging	Het
Ccng2	C	G	5: 93,273,343	S237R	probably benign	Het
Chek2	T	G	5: 110,840,050		probably null	Het
Cldn14	A	G	16: 93,919,727	L77S	probably damaging	Het
Cox15	T	C	19: 43,739,941	K298E	possibly damaging	Het
Cpt1b	G	T	15: 89,421,404	D369E	probably benign	Het
Cpxm1	T	C	2: 130,393,422	N550S	probably benign	Het
Csdc2	A	G	15: 81,949,198	E132G	possibly damaging	Het
Cyb5d2	A	T	11: 72,778,876	C219S	probably damaging	Het
Erbb4	T	C	1: 68,328,119	T480A	probably benign	Het
Fndc1	G	A	17: 7,765,137	T1319I	unknown	Het
Gm5773	T	G	3: 93,773,258	V79G	probably damaging	Het
Hsf2	G	A	10: 57,511,335		probably null	Het
Itgb2l	T	C	16: 96,437,408	T64A	probably damaging	Het
Kifc5b	T	C	17: 26,924,202	V316A	probably damaging	Het
Ktn1	A	G	14: 47,670,293	D279G	probably damaging	Het
Lonrf1	T	C	8: 36,249,052	E143G	possibly damaging	Het
Mroh9	C	T	1: 163,024,553	E856K	probably benign	Het
Muc16	T	C	9: 18,657,477	T1249A	unknown	Het
Myh6	G	A	14: 54,957,150	R721W	probably damaging	Het
Myo6	A	T	9: 80,276,329	I669F	unknown	Het
N4bp2	A	G	5: 65,808,459	T1284A	probably damaging	Het
Npr3	A	G	15: 11,905,638	M1T	probably null	Het
Obscn	C	T	11: 59,099,777	V1657M	probably damaging	Het
Olfr243	A	G	7: 103,717,353	E253G	possibly damaging	Het
Olfr551	A	T	7: 102,588,431	F104Y	probably benign	Het
Olfr908	A	G	9: 38,516,328	T99A	possibly damaging	Het
Otud6b	C	A	4: 14,818,389	A171S	possibly damaging	Het
Pdcd2l	A	C	7: 34,192,831	D204E	probably benign	Het
Pdia2	T	C	17: 26,198,868	S56G	probably benign	Het
Plcxd1	G	A	5: 110,102,503	E237K	possibly damaging	Het
Plekha5	A	T	6: 140,555,986	R633S	probably damaging	Het
Pnpla6	T	C	8: 3,536,594	F937L	possibly damaging	Het
Pth2	A	T	7: 45,181,309	M6L	probably benign	Het
Ptprd	T	A	4: 76,086,089	K143I	probably damaging	Het
Rhbdf2	T	C	11: 116,601,601	D487G	probably benign	Het
Rhbdf2	A	T	11: 116,603,949	D300E	probably benign	Het
Rock2	G	A	12: 16,976,047	V1265I	probably damaging	Het
Rsf1	CGGC	CGGCGGCGGAGGC	7: 97,579,932		probably benign	Het
Rtn4	T	A	11: 29,733,790	Y1027*	probably null	Het
Rxfp3	A	G	15: 11,037,130	L52P	probably damaging	Het
Sel1l3	A	G	5: 53,135,885	Y830H	probably benign	Het
Serpinb3d	C	T	1: 107,079,358	V207I	probably damaging	Het
Sipa1l2	T	C	8: 125,464,233	E1006G	probably damaging	Het
Slc22a19	C	T	19: 7,683,836	M324I	possibly damaging	Het
Slc37a1	T	A	17: 31,316,185	F106I	probably damaging	Het
Snx14	A	T	9: 88,398,349	S518T	probably benign	Het
Sp2	T	C	11: 96,961,109	T330A	probably damaging	Het
Spata13	A	T	14: 60,756,249	H1050L	probably damaging	Het
Sptssa	A	C	12: 54,656,416	V23G	possibly damaging	Het
Syt3	A	T	7: 44,392,667	I317F	probably damaging	Het
Tars	A	C	15: 11,399,372		probably null	Het
Tead3	T	A	17: 28,332,827	T431S	probably benign	Het
Tiam2	G	A	17: 3,518,156	E1526K	possibly damaging	Het
Tnni3	G	A	7: 4,521,892	P12L	probably benign	Het
Topaz1	A	G	9: 122,785,136	H1207R	probably benign	Het
Trdn	G	T	10: 33,257,062	E107*	probably null	Het
Trp63	A	G	16: 25,882,625	N483S	probably benign	Het
Trpm4	A	G	7: 45,308,338	S1009P	probably benign	Het
Trpm6	T	C	19: 18,827,408	V908A	probably benign	Het
Tsen34	A	T	7: 3,694,602	M25L	possibly damaging	Het
Ttn	T	C	2: 76,951,483	E1073G	unknown	Het
Uaca	A	T	9: 60,876,395	I1380F	probably damaging	Het
Ubr3	A	G	2: 69,944,449	T539A	probably benign	Het
Ugt1a5	T	A	1: 88,166,395	M115K	probably benign	Het
Unc45b	A	T	11: 82,922,900	I378F	probably damaging	Het
Unk	G	A	11: 116,049,436	R205Q	possibly damaging	Het
Ush2a	T	A	1: 188,810,179	L3314Q	probably benign	Het
Vezt	A	G	10: 93,980,424	L475P	probably damaging	Het
Vmn2r115	C	T	17: 23,345,798	Q220*	probably null	Het
Yap1	T	C	9: 7,962,378	Q223R	probably benign	Het
Zdhhc7	G	A	8: 120,086,728	T114M	possibly damaging	Het
Zwilch	A	C	9: 64,152,935	C374G	probably damaging	Het

Other mutations in Agbl3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00336:Agbl3	APN	6	34846836	missense	probably damaging	1.00
IGL00835:Agbl3	APN	6	34799732	missense	probably damaging	1.00
IGL00840:Agbl3	APN	6	34799159	missense	possibly damaging	0.95
IGL01090:Agbl3	APN	6	34799887	missense	probably benign	0.40
IGL01123:Agbl3	APN	6	34846976	nonsense	probably null
IGL01707:Agbl3	APN	6	34839454	missense	possibly damaging	0.78
IGL01728:Agbl3	APN	6	34782157	start codon destroyed	probably null
IGL02335:Agbl3	APN	6	34799750	missense	probably damaging	1.00
IGL02420:Agbl3	APN	6	34785307	missense	possibly damaging	0.47
IGL02551:Agbl3	APN	6	34823071	missense	possibly damaging	0.88
IGL02974:Agbl3	APN	6	34799822	missense	probably damaging	1.00
IGL03167:Agbl3	APN	6	34857659	missense	possibly damaging	0.92
IGL03182:Agbl3	APN	6	34803500	missense	probably damaging	1.00
R0044:Agbl3	UTSW	6	34799899	missense	probably damaging	1.00
R0499:Agbl3	UTSW	6	34839335	missense	probably benign
R0639:Agbl3	UTSW	6	34799705	missense	probably damaging	1.00
R0850:Agbl3	UTSW	6	34799204	missense	probably damaging	1.00
R1004:Agbl3	UTSW	6	34803451	missense	probably damaging	0.99
R1080:Agbl3	UTSW	6	34828235	missense	probably benign	0.14
R1589:Agbl3	UTSW	6	34857517	missense	possibly damaging	0.77
R2361:Agbl3	UTSW	6	34832505	missense	possibly damaging	0.87
R2495:Agbl3	UTSW	6	34846764	missense	probably damaging	1.00
R3236:Agbl3	UTSW	6	34823087	splice site	probably null
R3237:Agbl3	UTSW	6	34823087	splice site	probably null
R3420:Agbl3	UTSW	6	34793965	missense	probably benign	0.36
R3421:Agbl3	UTSW	6	34793965	missense	probably benign	0.36
R3422:Agbl3	UTSW	6	34793965	missense	probably benign	0.36
R3810:Agbl3	UTSW	6	34799729	missense	probably damaging	1.00
R3811:Agbl3	UTSW	6	34799729	missense	probably damaging	1.00
R4059:Agbl3	UTSW	6	34846899	missense	probably damaging	1.00
R4499:Agbl3	UTSW	6	34857598	missense	probably benign	0.00
R4687:Agbl3	UTSW	6	34798326	missense	probably damaging	1.00
R4854:Agbl3	UTSW	6	34785284	missense	probably damaging	0.97
R5354:Agbl3	UTSW	6	34814752	missense	probably benign	0.03
R5386:Agbl3	UTSW	6	34799196	missense	probably damaging	1.00
R5897:Agbl3	UTSW	6	34803573	missense	probably benign	0.21
R6018:Agbl3	UTSW	6	34799255	missense	probably damaging	1.00
R6148:Agbl3	UTSW	6	34857753	missense	possibly damaging	0.87
R6305:Agbl3	UTSW	6	34782210	missense	unknown
R6525:Agbl3	UTSW	6	34803594	nonsense	probably null
R6546:Agbl3	UTSW	6	34799299	missense	probably damaging	1.00
R6743:Agbl3	UTSW	6	34846953	missense	probably benign	0.03
R6986:Agbl3	UTSW	6	34839452	missense	probably benign	0.42
R7023:Agbl3	UTSW	6	34814769	missense	probably benign	0.02
R7411:Agbl3	UTSW	6	34814819	missense	probably damaging	0.99
R7469:Agbl3	UTSW	6	34814414	missense	probably damaging	1.00
R7631:Agbl3	UTSW	6	34857671	missense	possibly damaging	0.95
R7658:Agbl3	UTSW	6	34832508	missense	probably benign	0.11
R7801:Agbl3	UTSW	6	34839365	missense	probably benign	0.00
R8033:Agbl3	UTSW	6	34839494	missense	possibly damaging	0.95
R8203:Agbl3	UTSW	6	34799479	missense	probably damaging	1.00
R8769:Agbl3	UTSW	6	34857614	missense	probably damaging	0.96
R9072:Agbl3	UTSW	6	34799452	missense	probably damaging	1.00
R9073:Agbl3	UTSW	6	34799452	missense	probably damaging	1.00
R9210:Agbl3	UTSW	6	34798242	missense	probably damaging	0.98
R9255:Agbl3	UTSW	6	34812905	missense	probably damaging	1.00
RF014:Agbl3	UTSW	6	34799358	missense	possibly damaging	0.53
Z1177:Agbl3	UTSW	6	34799408	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGGCTATGACAGTGGCTCTC -3'
(R):5'- ACGAACACCATTGACTTACTGATGC -3'

Sequencing Primer
(F):5'- ATGACAGTGGCTCTCAACCTGTG -3'
(R):5'- ACACCATTGACTTACTGATGCTGTTG -3'

Posted On

2019-11-26