Incidental Mutation 'R0067:Pbk'
ID59667
Institutional Source Beutler Lab
Gene Symbol Pbk
Ensembl Gene ENSMUSG00000022033
Gene NamePDZ binding kinase
Synonyms2810434B10Rik, TOPK, D14Ertd732e
MMRRC Submission 038358-MU
Accession Numbers

Genbank: NM_023209; MGI: 1289156

Is this an essential gene? Possibly non essential (E-score: 0.311) question?
Stock #R0067 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location65805837-65817822 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 65815226 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 173 (V173I)
Ref Sequence ENSEMBL: ENSMUSP00000022612 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022612] [ENSMUST00000022613] [ENSMUST00000139644]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022612
AA Change: V173I

PolyPhen 2 Score 0.905 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000022612
Gene: ENSMUSG00000022033
AA Change: V173I

DomainStartEndE-ValueType
Pfam:Pkinase 32 317 1.7e-40 PFAM
Pfam:Pkinase_Tyr 32 317 2.4e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000022613
SMART Domains Protein: ENSMUSP00000022613
Gene: ENSMUSG00000022034

DomainStartEndE-ValueType
low complexity region 139 156 N/A INTRINSIC
low complexity region 229 243 N/A INTRINSIC
Pfam:zf-C2H2_3 371 410 1.6e-18 PFAM
Pfam:Acetyltransf_13 520 588 2e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139644
SMART Domains Protein: ENSMUSP00000114484
Gene: ENSMUSG00000022033

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 32 119 3.5e-5 PFAM
Pfam:Pkinase 32 120 7.2e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152130
Meta Mutation Damage Score 0.1633 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.3%
Validation Efficiency 97% (63/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine/threonine protein kinase related to the dual specific mitogen-activated protein kinase kinase (MAPKK) family. Evidence suggests that mitotic phosphorylation is required for its catalytic activity. The encoded protein may be involved in the activation of lymphoid cells and support testicular functions, with a suggested role in the process of spermatogenesis. Overexpression of this gene has been implicated in tumorigenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased UV-induced loss of the horny layer, epidermis thickening, skin fibrosis, and deposition of extracellular matrix in the skin. [provided by MGI curators]
Allele List at MGI

All alleles(14) : Gene trapped(14)

Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn4 C T 7: 28,911,570 V248M possibly damaging Het
Adamts9 T A 6: 92,890,167 K79N probably damaging Het
AW209491 A T 13: 14,637,743 I394F probably benign Het
C130026I21Rik T A 1: 85,270,052 N5Y probably benign Het
Cacna1d A T 14: 30,075,010 probably benign Het
Cacna1i A T 15: 80,381,172 I1542F probably damaging Het
Cep97 A T 16: 55,915,561 N291K possibly damaging Het
Clasp2 A T 9: 113,860,141 probably benign Het
Coq8b T C 7: 27,233,481 L5P possibly damaging Het
Dennd1c T C 17: 57,075,465 Q67R probably damaging Het
Dysf T C 6: 84,063,331 V119A possibly damaging Het
Eml1 A G 12: 108,463,527 D23G possibly damaging Het
Eva1c A T 16: 90,866,417 D13V possibly damaging Het
Fam151b T C 13: 92,473,996 K95R probably benign Het
Glo1 A T 17: 30,594,271 probably null Het
Gm11360 T A 13: 27,956,231 M26K probably benign Het
Gps2 C T 11: 69,914,781 Q42* probably null Het
Gypa A G 8: 80,503,081 H102R possibly damaging Het
Hdac4 G A 1: 92,029,984 H103Y probably damaging Het
Hivep1 T A 13: 42,158,656 D1457E probably benign Het
Hunk A G 16: 90,447,312 D110G probably damaging Het
L3mbtl1 A G 2: 162,948,828 K225E probably damaging Het
Limch1 A G 5: 66,974,622 S143G probably damaging Het
Macf1 T C 4: 123,475,248 K342E possibly damaging Het
Mc5r T A 18: 68,339,566 M332K probably damaging Het
Memo1 A G 17: 74,225,458 V185A probably damaging Het
Myf6 A T 10: 107,493,479 probably null Het
Myh14 G A 7: 44,623,127 T1418I probably benign Het
Plekha5 C T 6: 140,524,903 T90I probably damaging Het
Ptbp2 T C 3: 119,720,641 T478A probably benign Het
Rasgrp1 C A 2: 117,294,820 R246S probably damaging Het
Rflnb A T 11: 76,022,161 S134T possibly damaging Het
Rnf214 A G 9: 45,867,498 probably null Het
Rps6ka5 T A 12: 100,616,083 I177F probably damaging Het
Rtn2 T A 7: 19,294,471 probably benign Het
Satb1 T C 17: 51,804,336 T165A probably damaging Het
Scamp1 T C 13: 94,204,150 Y237C probably damaging Het
Skint10 A T 4: 112,711,556 F321L probably benign Het
Skiv2l2 C T 13: 112,886,862 V727I probably benign Het
Slc36a2 A G 11: 55,162,640 probably benign Het
Slc8a1 A G 17: 81,437,759 V672A probably benign Het
Slitrk6 A T 14: 110,749,932 L781H probably damaging Het
Spats2 C A 15: 99,212,287 P522T possibly damaging Het
Stkld1 A T 2: 26,949,340 E339D probably benign Het
Tbc1d9 A G 8: 83,234,243 T241A probably damaging Het
Ticrr A T 7: 79,677,410 D622V probably damaging Het
Tie1 A G 4: 118,476,280 probably benign Het
Trak1 G C 9: 121,472,907 V910L probably damaging Het
Trmt1l T C 1: 151,448,380 V326A probably benign Het
Tshr A G 12: 91,505,283 T136A probably damaging Het
Ube3c A G 5: 29,598,938 T180A possibly damaging Het
Unc13a A C 8: 71,634,658 F1482V probably damaging Het
Unc79 A G 12: 103,059,518 E388G probably damaging Het
Ush2a A T 1: 188,964,846 D5167V probably damaging Het
Vmn2r93 A T 17: 18,326,410 H848L probably benign Het
Wdfy4 G A 14: 33,162,751 R65C probably null Het
Zcchc9 T C 13: 91,797,249 I72V probably benign Het
Zfc3h1 G T 10: 115,423,474 L1650F possibly damaging Het
Zzz3 A G 3: 152,428,403 D366G possibly damaging Het
Other mutations in Pbk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Pbk APN 14 65813891 missense probably damaging 1.00
IGL00858:Pbk APN 14 65811924 splice site probably benign
IGL01472:Pbk APN 14 65816710 missense probably benign 0.06
IGL03239:Pbk APN 14 65817218 missense probably benign 0.22
A5278:Pbk UTSW 14 65813939 missense probably damaging 1.00
R0645:Pbk UTSW 14 65813796 splice site probably benign
R4696:Pbk UTSW 14 65811937 missense probably benign 0.00
R4834:Pbk UTSW 14 65815284 nonsense probably null
R4856:Pbk UTSW 14 65815201 missense probably damaging 1.00
R4886:Pbk UTSW 14 65815201 missense probably damaging 1.00
R6006:Pbk UTSW 14 65816645 missense probably damaging 0.97
R6086:Pbk UTSW 14 65815253 nonsense probably null
R7272:Pbk UTSW 14 65815172 missense probably damaging 1.00
Z1088:Pbk UTSW 14 65813948 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGACATGGCAGGTCATCTAAATGGAC -3'
(R):5'- ATGCTAATAAGGGCCAGTGCGG -3'

Sequencing Primer
(F):5'- ggctgtcctggaacttctc -3'
(R):5'- CCTGTGAGCCCAACTGAC -3'
Posted On2013-07-11