Incidental Mutation 'R0067:Cacna1i'
ID 59669
Institutional Source Beutler Lab
Gene Symbol Cacna1i
Ensembl Gene ENSMUSG00000022416
Gene Name calcium channel, voltage-dependent, alpha 1I subunit
Synonyms
MMRRC Submission 038358-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0067 (G1)
Quality Score 177
Status Validated
Chromosome 15
Chromosomal Location 80171439-80282480 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 80265373 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 1542 (I1542F)
Ref Sequence ENSEMBL: ENSMUSP00000125229 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000160424] [ENSMUST00000162155]
AlphaFold E9Q7P2
Predicted Effect probably damaging
Transcript: ENSMUST00000160424
AA Change: I1542F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125063
Gene: ENSMUSG00000022416
AA Change: I1542F

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 24 40 N/A INTRINSIC
Pfam:Ion_trans 76 407 1.4e-79 PFAM
low complexity region 464 482 N/A INTRINSIC
low complexity region 531 554 N/A INTRINSIC
Pfam:Ion_trans 597 830 7.4e-58 PFAM
low complexity region 870 892 N/A INTRINSIC
low complexity region 919 940 N/A INTRINSIC
low complexity region 984 1015 N/A INTRINSIC
low complexity region 1069 1080 N/A INTRINSIC
Pfam:Ion_trans 1128 1401 7.8e-65 PFAM
Pfam:Ion_trans 1445 1700 9.4e-58 PFAM
Pfam:PKD_channel 1538 1694 1.4e-10 PFAM
low complexity region 1718 1739 N/A INTRINSIC
low complexity region 1744 1760 N/A INTRINSIC
low complexity region 1837 1853 N/A INTRINSIC
low complexity region 1922 1933 N/A INTRINSIC
low complexity region 1990 2005 N/A INTRINSIC
low complexity region 2041 2058 N/A INTRINSIC
low complexity region 2087 2097 N/A INTRINSIC
low complexity region 2103 2126 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000162155
AA Change: I1542F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125229
Gene: ENSMUSG00000022416
AA Change: I1542F

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 24 40 N/A INTRINSIC
Pfam:Ion_trans 115 395 1.9e-66 PFAM
low complexity region 464 482 N/A INTRINSIC
low complexity region 531 554 N/A INTRINSIC
Pfam:Ion_trans 632 819 2.4e-45 PFAM
low complexity region 870 892 N/A INTRINSIC
low complexity region 919 940 N/A INTRINSIC
low complexity region 984 1015 N/A INTRINSIC
low complexity region 1069 1080 N/A INTRINSIC
Pfam:Ion_trans 1165 1389 6.2e-55 PFAM
coiled coil region 1394 1426 N/A INTRINSIC
Pfam:Ion_trans 1480 1688 1.9e-47 PFAM
Pfam:PKD_channel 1538 1694 4.8e-10 PFAM
low complexity region 1718 1739 N/A INTRINSIC
low complexity region 1744 1760 N/A INTRINSIC
Meta Mutation Damage Score 0.6622 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.3%
Validation Efficiency 97% (63/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the pore-forming alpha subunit of a voltage gated calcium channel. The encoded protein is a member of a subfamily of calcium channels referred to as is a low voltage-activated, T-type, calcium channel. The channel encoded by this protein is characterized by a slower activation and inactivation compared to other T-type calcium channels. This protein may be involved in calcium signaling in neurons. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2011]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn4 C T 7: 28,610,995 (GRCm39) V248M possibly damaging Het
Adamts9 T A 6: 92,867,148 (GRCm39) K79N probably damaging Het
AW209491 A T 13: 14,812,328 (GRCm39) I394F probably benign Het
Cacna1d A T 14: 29,796,967 (GRCm39) probably benign Het
Cep97 A T 16: 55,735,924 (GRCm39) N291K possibly damaging Het
Clasp2 A T 9: 113,689,209 (GRCm39) probably benign Het
Coq8b T C 7: 26,932,906 (GRCm39) L5P possibly damaging Het
Dennd1c T C 17: 57,382,465 (GRCm39) Q67R probably damaging Het
Dysf T C 6: 84,040,313 (GRCm39) V119A possibly damaging Het
Eml1 A G 12: 108,429,786 (GRCm39) D23G possibly damaging Het
Eva1c A T 16: 90,663,305 (GRCm39) D13V possibly damaging Het
Fam151b T C 13: 92,610,504 (GRCm39) K95R probably benign Het
Glo1 A T 17: 30,813,245 (GRCm39) probably null Het
Gm11360 T A 13: 28,140,214 (GRCm39) M26K probably benign Het
Gps2 C T 11: 69,805,607 (GRCm39) Q42* probably null Het
Gypa A G 8: 81,229,710 (GRCm39) H102R possibly damaging Het
Hdac4 G A 1: 91,957,706 (GRCm39) H103Y probably damaging Het
Hivep1 T A 13: 42,312,132 (GRCm39) D1457E probably benign Het
Hunk A G 16: 90,244,200 (GRCm39) D110G probably damaging Het
L3mbtl1 A G 2: 162,790,748 (GRCm39) K225E probably damaging Het
Limch1 A G 5: 67,131,965 (GRCm39) S143G probably damaging Het
Macf1 T C 4: 123,369,041 (GRCm39) K342E possibly damaging Het
Mc5r T A 18: 68,472,637 (GRCm39) M332K probably damaging Het
Memo1 A G 17: 74,532,453 (GRCm39) V185A probably damaging Het
Mtrex C T 13: 113,023,396 (GRCm39) V727I probably benign Het
Myf6 A T 10: 107,329,340 (GRCm39) probably null Het
Myh14 G A 7: 44,272,551 (GRCm39) T1418I probably benign Het
Pbk G A 14: 66,052,675 (GRCm39) V173I possibly damaging Het
Plekha5 C T 6: 140,470,629 (GRCm39) T90I probably damaging Het
Ptbp2 T C 3: 119,514,290 (GRCm39) T478A probably benign Het
Rasgrp1 C A 2: 117,125,301 (GRCm39) R246S probably damaging Het
Rflnb A T 11: 75,912,987 (GRCm39) S134T possibly damaging Het
Rnf214 A G 9: 45,778,796 (GRCm39) probably null Het
Rps6ka5 T A 12: 100,582,342 (GRCm39) I177F probably damaging Het
Rtn2 T A 7: 19,028,396 (GRCm39) probably benign Het
Satb1 T C 17: 52,111,364 (GRCm39) T165A probably damaging Het
Scamp1 T C 13: 94,340,658 (GRCm39) Y237C probably damaging Het
Skint10 A T 4: 112,568,753 (GRCm39) F321L probably benign Het
Slc36a2 A G 11: 55,053,466 (GRCm39) probably benign Het
Slc8a1 A G 17: 81,745,188 (GRCm39) V672A probably benign Het
Slitrk6 A T 14: 110,987,364 (GRCm39) L781H probably damaging Het
Sp140l2 T A 1: 85,247,773 (GRCm39) N5Y probably benign Het
Spats2 C A 15: 99,110,168 (GRCm39) P522T possibly damaging Het
Stkld1 A T 2: 26,839,352 (GRCm39) E339D probably benign Het
Tbc1d9 A G 8: 83,960,872 (GRCm39) T241A probably damaging Het
Ticrr A T 7: 79,327,158 (GRCm39) D622V probably damaging Het
Tie1 A G 4: 118,333,477 (GRCm39) probably benign Het
Trak1 G C 9: 121,301,973 (GRCm39) V910L probably damaging Het
Trmt1l T C 1: 151,324,131 (GRCm39) V326A probably benign Het
Tshr A G 12: 91,472,057 (GRCm39) T136A probably damaging Het
Ube3c A G 5: 29,803,936 (GRCm39) T180A possibly damaging Het
Unc13a A C 8: 72,087,302 (GRCm39) F1482V probably damaging Het
Unc79 A G 12: 103,025,777 (GRCm39) E388G probably damaging Het
Ush2a A T 1: 188,697,043 (GRCm39) D5167V probably damaging Het
Vmn2r93 A T 17: 18,546,672 (GRCm39) H848L probably benign Het
Wdfy4 G A 14: 32,884,708 (GRCm39) R65C probably null Het
Zcchc9 T C 13: 91,945,368 (GRCm39) I72V probably benign Het
Zfc3h1 G T 10: 115,259,379 (GRCm39) L1650F possibly damaging Het
Zzz3 A G 3: 152,134,040 (GRCm39) D366G possibly damaging Het
Other mutations in Cacna1i
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Cacna1i APN 15 80,266,220 (GRCm39) missense probably damaging 1.00
IGL00976:Cacna1i APN 15 80,239,846 (GRCm39) missense probably benign
IGL01338:Cacna1i APN 15 80,232,581 (GRCm39) missense probably damaging 0.99
IGL01589:Cacna1i APN 15 80,271,960 (GRCm39) splice site probably benign
IGL01669:Cacna1i APN 15 80,275,958 (GRCm39) missense probably benign
IGL01807:Cacna1i APN 15 80,258,348 (GRCm39) missense probably damaging 1.00
IGL01911:Cacna1i APN 15 80,275,933 (GRCm39) missense probably benign 0.09
IGL01973:Cacna1i APN 15 80,266,234 (GRCm39) missense probably damaging 1.00
IGL02205:Cacna1i APN 15 80,257,152 (GRCm39) missense probably benign 0.06
IGL02519:Cacna1i APN 15 80,246,075 (GRCm39) nonsense probably null
IGL02648:Cacna1i APN 15 80,182,839 (GRCm39) missense probably damaging 0.96
IGL03033:Cacna1i APN 15 80,246,440 (GRCm39) missense probably damaging 0.98
IGL03214:Cacna1i APN 15 80,239,917 (GRCm39) missense probably benign 0.30
R0067:Cacna1i UTSW 15 80,265,373 (GRCm39) missense probably damaging 1.00
R0295:Cacna1i UTSW 15 80,240,412 (GRCm39) missense probably damaging 1.00
R0345:Cacna1i UTSW 15 80,256,663 (GRCm39) missense probably damaging 0.98
R0415:Cacna1i UTSW 15 80,253,031 (GRCm39) splice site probably benign
R0637:Cacna1i UTSW 15 80,256,855 (GRCm39) missense probably damaging 0.99
R0638:Cacna1i UTSW 15 80,265,281 (GRCm39) missense possibly damaging 0.94
R0840:Cacna1i UTSW 15 80,243,150 (GRCm39) missense possibly damaging 0.85
R1463:Cacna1i UTSW 15 80,263,255 (GRCm39) missense possibly damaging 0.96
R1528:Cacna1i UTSW 15 80,275,975 (GRCm39) splice site probably null
R1563:Cacna1i UTSW 15 80,205,389 (GRCm39) missense probably damaging 0.97
R1563:Cacna1i UTSW 15 80,274,056 (GRCm39) splice site probably benign
R1573:Cacna1i UTSW 15 80,277,869 (GRCm39) splice site probably null
R1654:Cacna1i UTSW 15 80,273,411 (GRCm39) missense probably damaging 1.00
R1754:Cacna1i UTSW 15 80,255,730 (GRCm39) missense probably damaging 0.99
R1794:Cacna1i UTSW 15 80,273,323 (GRCm39) missense probably damaging 1.00
R1824:Cacna1i UTSW 15 80,260,990 (GRCm39) missense possibly damaging 0.64
R1863:Cacna1i UTSW 15 80,243,132 (GRCm39) missense probably damaging 1.00
R1885:Cacna1i UTSW 15 80,243,145 (GRCm39) missense probably damaging 0.99
R1886:Cacna1i UTSW 15 80,243,145 (GRCm39) missense probably damaging 0.99
R1899:Cacna1i UTSW 15 80,275,843 (GRCm39) missense possibly damaging 0.91
R1907:Cacna1i UTSW 15 80,259,465 (GRCm39) missense probably damaging 1.00
R1943:Cacna1i UTSW 15 80,279,245 (GRCm39) missense probably benign
R2162:Cacna1i UTSW 15 80,240,388 (GRCm39) missense probably damaging 1.00
R2888:Cacna1i UTSW 15 80,258,968 (GRCm39) missense probably damaging 1.00
R3701:Cacna1i UTSW 15 80,265,272 (GRCm39) splice site probably benign
R3702:Cacna1i UTSW 15 80,265,272 (GRCm39) splice site probably benign
R3832:Cacna1i UTSW 15 80,240,388 (GRCm39) missense probably damaging 1.00
R4852:Cacna1i UTSW 15 80,272,680 (GRCm39) missense probably damaging 0.99
R4857:Cacna1i UTSW 15 80,253,863 (GRCm39) missense probably damaging 1.00
R4950:Cacna1i UTSW 15 80,252,872 (GRCm39) missense probably damaging 1.00
R4980:Cacna1i UTSW 15 80,232,650 (GRCm39) missense probably damaging 0.97
R5217:Cacna1i UTSW 15 80,275,041 (GRCm39) missense possibly damaging 0.94
R5437:Cacna1i UTSW 15 80,255,730 (GRCm39) missense probably damaging 1.00
R5519:Cacna1i UTSW 15 80,255,700 (GRCm39) missense probably damaging 1.00
R5642:Cacna1i UTSW 15 80,279,279 (GRCm39) missense possibly damaging 0.47
R6217:Cacna1i UTSW 15 80,273,333 (GRCm39) missense probably damaging 1.00
R6225:Cacna1i UTSW 15 80,205,427 (GRCm39) missense probably damaging 1.00
R6251:Cacna1i UTSW 15 80,220,883 (GRCm39) missense probably damaging 1.00
R6463:Cacna1i UTSW 15 80,239,959 (GRCm39) missense probably damaging 0.97
R6490:Cacna1i UTSW 15 80,262,448 (GRCm39) missense probably damaging 1.00
R6613:Cacna1i UTSW 15 80,205,460 (GRCm39) missense probably damaging 1.00
R6884:Cacna1i UTSW 15 80,259,010 (GRCm39) missense probably damaging 1.00
R6904:Cacna1i UTSW 15 80,259,002 (GRCm39) missense probably damaging 1.00
R7017:Cacna1i UTSW 15 80,264,671 (GRCm39) missense probably damaging 1.00
R7155:Cacna1i UTSW 15 80,279,439 (GRCm39) missense probably benign 0.04
R7274:Cacna1i UTSW 15 80,261,023 (GRCm39) missense possibly damaging 0.95
R7323:Cacna1i UTSW 15 80,275,854 (GRCm39) missense possibly damaging 0.86
R7335:Cacna1i UTSW 15 80,259,776 (GRCm39) missense probably damaging 1.00
R7571:Cacna1i UTSW 15 80,259,537 (GRCm39) missense probably damaging 1.00
R7768:Cacna1i UTSW 15 80,265,389 (GRCm39) missense probably damaging 1.00
R7820:Cacna1i UTSW 15 80,256,573 (GRCm39) missense probably benign 0.00
R7987:Cacna1i UTSW 15 80,204,553 (GRCm39) splice site probably null
R8150:Cacna1i UTSW 15 80,259,540 (GRCm39) missense probably damaging 1.00
R8206:Cacna1i UTSW 15 80,274,016 (GRCm39) splice site probably null
R8270:Cacna1i UTSW 15 80,257,835 (GRCm39) missense probably damaging 0.99
R8382:Cacna1i UTSW 15 80,261,017 (GRCm39) missense probably damaging 0.99
R8501:Cacna1i UTSW 15 80,266,247 (GRCm39) critical splice donor site probably null
R8518:Cacna1i UTSW 15 80,243,095 (GRCm39) nonsense probably null
R8552:Cacna1i UTSW 15 80,204,598 (GRCm39) missense possibly damaging 0.69
R8679:Cacna1i UTSW 15 80,260,011 (GRCm39) intron probably benign
R8696:Cacna1i UTSW 15 80,266,175 (GRCm39) missense probably damaging 0.98
R8887:Cacna1i UTSW 15 80,258,894 (GRCm39) missense possibly damaging 0.91
R9274:Cacna1i UTSW 15 80,254,354 (GRCm39) missense probably damaging 1.00
R9379:Cacna1i UTSW 15 80,259,495 (GRCm39) missense probably damaging 1.00
R9508:Cacna1i UTSW 15 80,279,372 (GRCm39) missense probably benign 0.06
R9518:Cacna1i UTSW 15 80,271,978 (GRCm39) missense probably damaging 1.00
R9674:Cacna1i UTSW 15 80,264,629 (GRCm39) missense probably damaging 1.00
R9747:Cacna1i UTSW 15 80,246,318 (GRCm39) missense probably benign 0.11
R9769:Cacna1i UTSW 15 80,253,793 (GRCm39) missense probably damaging 1.00
X0022:Cacna1i UTSW 15 80,246,163 (GRCm39) missense probably damaging 0.99
X0024:Cacna1i UTSW 15 80,246,340 (GRCm39) missense probably benign 0.03
X0058:Cacna1i UTSW 15 80,263,303 (GRCm39) missense probably damaging 1.00
Z1177:Cacna1i UTSW 15 80,273,584 (GRCm39) missense possibly damaging 0.94
Z1177:Cacna1i UTSW 15 80,265,380 (GRCm39) missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- GGTGTGTCTGAGCCACTATGCTTC -3'
(R):5'- TTCTTTGTGCCACATCCTGAGACTG -3'

Sequencing Primer
(F):5'- GAGCCACTATGCTTCTCCCTC -3'
(R):5'- ACTGGACCACATGGATTATGCTG -3'
Posted On 2013-07-11