Mutagenetix > Incidental Mutation

Incidental Mutation 'R7743:Tiam2'

596702

Institutional Source

Beutler Lab

Gene Symbol

Tiam2

Ensembl Gene

ENSMUSG00000023800

Gene Name

T cell lymphoma invasion and metastasis 2

Synonyms

3000002F19Rik, STEF

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7743 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

3326573-3531344 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 3518156 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Lysine at position 1526 (E1526K)

Ref Sequence

ENSEMBL: ENSMUSP00000072020 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041003] [ENSMUST00000072156] [ENSMUST00000169838] [ENSMUST00000227405]

AlphaFold

Q6ZPF3

PDB Structure

Crystal structure of the Tiam2 PHCCEx domain [X-RAY DIFFRACTION]
Low-resolution crystal structure of the Tiam2 PHCCEx domain [X-RAY DIFFRACTION]

Predicted Effect

probably benign
Transcript: ENSMUST00000041003

SMART Domains

Protein: ENSMUSP00000035291
Gene: ENSMUSG00000036983

Domain	Start	End	E-Value	Type
rADc	43	234	5.56e-69	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000072156
AA Change: E1526K

PolyPhen 2 Score 0.532 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000072020
Gene: ENSMUSG00000023800
AA Change: E1526K

Domain	Start	End	E-Value	Type
low complexity region	230	245	N/A	INTRINSIC
low complexity region	267	281	N/A	INTRINSIC
low complexity region	471	492	N/A	INTRINSIC
PH	505	620	7.82e-16	SMART
RBD	831	902	1.32e-26	SMART
PDZ	921	995	2.38e-7	SMART
RhoGEF	1124	1313	2.23e-61	SMART
PH	1347	1478	2.86e0	SMART
low complexity region	1522	1532	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000169838
AA Change: E1526K

PolyPhen 2 Score 0.532 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000125842
Gene: ENSMUSG00000023800
AA Change: E1526K

Domain	Start	End	E-Value	Type
low complexity region	230	245	N/A	INTRINSIC
low complexity region	267	281	N/A	INTRINSIC
low complexity region	471	492	N/A	INTRINSIC
PH	505	620	7.82e-16	SMART
RBD	831	902	1.32e-26	SMART
PDZ	921	995	2.38e-7	SMART
RhoGEF	1124	1313	2.23e-61	SMART
PH	1347	1478	2.86e0	SMART
low complexity region	1522	1532	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000227405

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

97% (77/79)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a guanine nucleotide exchange factor. A highly similar mouse protein specifically activates ras-related C3 botulinum substrate 1, converting this Rho-like guanosine triphosphatase (GTPase) from a guanosine diphosphate-bound inactive state to a guanosine triphosphate-bound active state. The encoded protein may play a role in neural cell development. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 83 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	A	G	3: 138,068,755	E1235G	probably damaging	Het
Adam6a	A	G	12: 113,544,532	D175G	probably benign	Het
Adgrf4	A	T	17: 42,672,562	C76*	probably null	Het
Agbl3	C	T	6: 34,846,830	T815I	probably damaging	Het
Ahnak2	A	G	12: 112,784,763	V488A	not run	Het
Akip1	T	A	7: 109,711,828	S192T	probably benign	Het
Apc2	G	A	10: 80,304,915	M201I	probably damaging	Het
Arel1	G	T	12: 84,940,269	N124K	probably damaging	Het
Atp10a	A	T	7: 58,803,709	H845L	probably damaging	Het
Atp2a2	A	G	5: 122,461,571	Y586H	probably benign	Het
BC051019	A	G	7: 109,716,059	Y330H	probably damaging	Het
Btbd11	A	T	10: 85,624,949	I569F	possibly damaging	Het
Ccng2	C	G	5: 93,273,343	S237R	probably benign	Het
Chek2	T	G	5: 110,840,050		probably null	Het
Cldn14	A	G	16: 93,919,727	L77S	probably damaging	Het
Cox15	T	C	19: 43,739,941	K298E	possibly damaging	Het
Cpt1b	G	T	15: 89,421,404	D369E	probably benign	Het
Cpxm1	T	C	2: 130,393,422	N550S	probably benign	Het
Csdc2	A	G	15: 81,949,198	E132G	possibly damaging	Het
Cyb5d2	A	T	11: 72,778,876	C219S	probably damaging	Het
Erbb4	T	C	1: 68,328,119	T480A	probably benign	Het
Fndc1	G	A	17: 7,765,137	T1319I	unknown	Het
Gm5773	T	G	3: 93,773,258	V79G	probably damaging	Het
Hsf2	G	A	10: 57,511,335		probably null	Het
Itgb2l	T	C	16: 96,437,408	T64A	probably damaging	Het
Kifc5b	T	C	17: 26,924,202	V316A	probably damaging	Het
Ktn1	A	G	14: 47,670,293	D279G	probably damaging	Het
Lonrf1	T	C	8: 36,249,052	E143G	possibly damaging	Het
Mroh9	C	T	1: 163,024,553	E856K	probably benign	Het
Muc16	T	C	9: 18,657,477	T1249A	unknown	Het
Myh6	G	A	14: 54,957,150	R721W	probably damaging	Het
Myo6	A	T	9: 80,276,329	I669F	unknown	Het
N4bp2	A	G	5: 65,808,459	T1284A	probably damaging	Het
Npr3	A	G	15: 11,905,638	M1T	probably null	Het
Obscn	C	T	11: 59,099,777	V1657M	probably damaging	Het
Olfr243	A	G	7: 103,717,353	E253G	possibly damaging	Het
Olfr551	A	T	7: 102,588,431	F104Y	probably benign	Het
Olfr908	A	G	9: 38,516,328	T99A	possibly damaging	Het
Otud6b	C	A	4: 14,818,389	A171S	possibly damaging	Het
Pdcd2l	A	C	7: 34,192,831	D204E	probably benign	Het
Pdia2	T	C	17: 26,198,868	S56G	probably benign	Het
Plcxd1	G	A	5: 110,102,503	E237K	possibly damaging	Het
Plekha5	A	T	6: 140,555,986	R633S	probably damaging	Het
Pnpla6	T	C	8: 3,536,594	F937L	possibly damaging	Het
Pth2	A	T	7: 45,181,309	M6L	probably benign	Het
Ptprd	T	A	4: 76,086,089	K143I	probably damaging	Het
Rhbdf2	T	C	11: 116,601,601	D487G	probably benign	Het
Rhbdf2	A	T	11: 116,603,949	D300E	probably benign	Het
Rock2	G	A	12: 16,976,047	V1265I	probably damaging	Het
Rsf1	CGGC	CGGCGGCGGAGGC	7: 97,579,932		probably benign	Het
Rtn4	T	A	11: 29,733,790	Y1027*	probably null	Het
Rxfp3	A	G	15: 11,037,130	L52P	probably damaging	Het
Sel1l3	A	G	5: 53,135,885	Y830H	probably benign	Het
Serpinb3d	C	T	1: 107,079,358	V207I	probably damaging	Het
Sipa1l2	T	C	8: 125,464,233	E1006G	probably damaging	Het
Slc22a19	C	T	19: 7,683,836	M324I	possibly damaging	Het
Slc37a1	T	A	17: 31,316,185	F106I	probably damaging	Het
Snx14	A	T	9: 88,398,349	S518T	probably benign	Het
Sp2	T	C	11: 96,961,109	T330A	probably damaging	Het
Spata13	A	T	14: 60,756,249	H1050L	probably damaging	Het
Sptssa	A	C	12: 54,656,416	V23G	possibly damaging	Het
Syt3	A	T	7: 44,392,667	I317F	probably damaging	Het
Tars	A	C	15: 11,399,372		probably null	Het
Tead3	T	A	17: 28,332,827	T431S	probably benign	Het
Tnni3	G	A	7: 4,521,892	P12L	probably benign	Het
Topaz1	A	G	9: 122,785,136	H1207R	probably benign	Het
Trdn	G	T	10: 33,257,062	E107*	probably null	Het
Trp63	A	G	16: 25,882,625	N483S	probably benign	Het
Trpm4	A	G	7: 45,308,338	S1009P	probably benign	Het
Trpm6	T	C	19: 18,827,408	V908A	probably benign	Het
Tsen34	A	T	7: 3,694,602	M25L	possibly damaging	Het
Ttn	T	C	2: 76,951,483	E1073G	unknown	Het
Uaca	A	T	9: 60,876,395	I1380F	probably damaging	Het
Ubr3	A	G	2: 69,944,449	T539A	probably benign	Het
Ugt1a5	T	A	1: 88,166,395	M115K	probably benign	Het
Unc45b	A	T	11: 82,922,900	I378F	probably damaging	Het
Unk	G	A	11: 116,049,436	R205Q	possibly damaging	Het
Ush2a	T	A	1: 188,810,179	L3314Q	probably benign	Het
Vezt	A	G	10: 93,980,424	L475P	probably damaging	Het
Vmn2r115	C	T	17: 23,345,798	Q220*	probably null	Het
Yap1	T	C	9: 7,962,378	Q223R	probably benign	Het
Zdhhc7	G	A	8: 120,086,728	T114M	possibly damaging	Het
Zwilch	A	C	9: 64,152,935	C374G	probably damaging	Het

Other mutations in Tiam2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01011:Tiam2	APN	17	3415028	missense	probably benign	0.21
IGL01320:Tiam2	APN	17	3505745	missense	probably damaging	1.00
IGL01384:Tiam2	APN	17	3427202	missense	probably benign	0.08
IGL01575:Tiam2	APN	17	3454316	missense	probably damaging	1.00
IGL01769:Tiam2	APN	17	3427290	missense	probably damaging	1.00
IGL02395:Tiam2	APN	17	3421481	missense	possibly damaging	0.49
IGL02652:Tiam2	APN	17	3439696	splice site	probably benign
IGL03102:Tiam2	APN	17	3509548	missense	probably damaging	1.00
IGL03222:Tiam2	APN	17	3438708	missense	probably damaging	0.97
Feste_burg	UTSW	17	3414622	frame shift	probably null
R0257:Tiam2	UTSW	17	3450813	missense	possibly damaging	0.49
R0420:Tiam2	UTSW	17	3502918	missense	probably benign	0.01
R0528:Tiam2	UTSW	17	3511071	missense	probably damaging	1.00
R0532:Tiam2	UTSW	17	3421646	missense	probably damaging	1.00
R0551:Tiam2	UTSW	17	3428954	missense	probably damaging	1.00
R0554:Tiam2	UTSW	17	3438681	nonsense	probably null
R0645:Tiam2	UTSW	17	3514698	missense	possibly damaging	0.92
R0726:Tiam2	UTSW	17	3512833	unclassified	probably benign
R1139:Tiam2	UTSW	17	3477267	missense	possibly damaging	0.55
R1392:Tiam2	UTSW	17	3414197	missense	possibly damaging	0.71
R1392:Tiam2	UTSW	17	3414197	missense	possibly damaging	0.71
R1529:Tiam2	UTSW	17	3516703	missense	probably benign	0.00
R1671:Tiam2	UTSW	17	3506834	missense	probably damaging	1.00
R1731:Tiam2	UTSW	17	3518423	missense	probably damaging	0.98
R1759:Tiam2	UTSW	17	3516003	missense	probably damaging	0.98
R1850:Tiam2	UTSW	17	3437235	missense	probably damaging	1.00
R1853:Tiam2	UTSW	17	3415135	missense	probably damaging	1.00
R1855:Tiam2	UTSW	17	3415135	missense	probably damaging	1.00
R1931:Tiam2	UTSW	17	3514725	missense	possibly damaging	0.68
R1932:Tiam2	UTSW	17	3514725	missense	possibly damaging	0.68
R1993:Tiam2	UTSW	17	3415126	nonsense	probably null
R2211:Tiam2	UTSW	17	3414918	nonsense	probably null
R2217:Tiam2	UTSW	17	3415114	missense	probably benign	0.34
R2278:Tiam2	UTSW	17	3427220	missense	probably damaging	0.96
R2407:Tiam2	UTSW	17	3477261	missense	probably benign	0.14
R2516:Tiam2	UTSW	17	3453382	missense	probably damaging	1.00
R2991:Tiam2	UTSW	17	3518250	missense	probably benign
R3086:Tiam2	UTSW	17	3421582	missense	probably damaging	1.00
R3121:Tiam2	UTSW	17	3439702	missense	probably benign	0.01
R3686:Tiam2	UTSW	17	3421684	missense	possibly damaging	0.87
R3740:Tiam2	UTSW	17	3414113	missense	possibly damaging	0.54
R3742:Tiam2	UTSW	17	3414113	missense	possibly damaging	0.54
R3826:Tiam2	UTSW	17	3507701	splice site	probably benign
R3829:Tiam2	UTSW	17	3507701	splice site	probably benign
R3844:Tiam2	UTSW	17	3421651	missense	probably damaging	0.98
R3970:Tiam2	UTSW	17	3428831	missense	probably damaging	1.00
R4060:Tiam2	UTSW	17	3428980	missense	probably benign	0.00
R4296:Tiam2	UTSW	17	3450845	missense	probably benign
R4357:Tiam2	UTSW	17	3450853	missense	probably damaging	1.00
R4368:Tiam2	UTSW	17	3414683	missense	probably benign	0.01
R4369:Tiam2	UTSW	17	3413967	start gained	probably benign
R4524:Tiam2	UTSW	17	3514711	missense	probably damaging	1.00
R4619:Tiam2	UTSW	17	3518342	missense	probably damaging	1.00
R4715:Tiam2	UTSW	17	3454168	missense	probably damaging	1.00
R4723:Tiam2	UTSW	17	3450317	missense	probably benign	0.00
R4979:Tiam2	UTSW	17	3505710	missense	probably damaging	1.00
R5182:Tiam2	UTSW	17	3438721	missense	probably damaging	1.00
R5451:Tiam2	UTSW	17	3428996	missense	probably damaging	1.00
R5728:Tiam2	UTSW	17	3414956	missense	probably damaging	0.99
R5827:Tiam2	UTSW	17	3448489	missense	probably benign	0.00
R5879:Tiam2	UTSW	17	3437265	missense	probably damaging	1.00
R5960:Tiam2	UTSW	17	3438640	missense	probably benign	0.24
R5974:Tiam2	UTSW	17	3414809	missense	possibly damaging	0.51
R6198:Tiam2	UTSW	17	3414121	missense	probably benign	0.06
R6222:Tiam2	UTSW	17	3453338	missense	probably damaging	0.96
R6295:Tiam2	UTSW	17	3509556	missense	probably damaging	1.00
R6355:Tiam2	UTSW	17	3414622	frame shift	probably null
R6356:Tiam2	UTSW	17	3414622	frame shift	probably null
R6454:Tiam2	UTSW	17	3438663	missense	probably benign	0.00
R6497:Tiam2	UTSW	17	3506827	missense	probably damaging	1.00
R6579:Tiam2	UTSW	17	3414622	frame shift	probably null
R6580:Tiam2	UTSW	17	3414622	frame shift	probably null
R6581:Tiam2	UTSW	17	3414622	frame shift	probably null
R6582:Tiam2	UTSW	17	3414622	frame shift	probably null
R6648:Tiam2	UTSW	17	3506873	missense	probably damaging	1.00
R6705:Tiam2	UTSW	17	3518243	missense	probably benign	0.01
R6758:Tiam2	UTSW	17	3518403	missense	probably benign	0.01
R6836:Tiam2	UTSW	17	3414380	missense	probably benign	0.17
R6924:Tiam2	UTSW	17	3507795	missense	probably damaging	1.00
R6977:Tiam2	UTSW	17	3518659	missense	probably damaging	1.00
R7051:Tiam2	UTSW	17	3448483	missense	probably damaging	0.99
R7151:Tiam2	UTSW	17	3448385	missense	probably benign	0.36
R7214:Tiam2	UTSW	17	3518412	missense	possibly damaging	0.85
R7332:Tiam2	UTSW	17	3453369	missense	probably damaging	1.00
R7334:Tiam2	UTSW	17	3503008	missense	possibly damaging	0.92
R7414:Tiam2	UTSW	17	3414113	missense	possibly damaging	0.54
R7660:Tiam2	UTSW	17	3482605	start codon destroyed	probably null	0.66
R7755:Tiam2	UTSW	17	3421316	missense	probably benign	0.01
R7805:Tiam2	UTSW	17	3509410	missense	probably damaging	1.00
R7813:Tiam2	UTSW	17	3437247	missense	probably damaging	1.00
R7842:Tiam2	UTSW	17	3518124	missense	possibly damaging	0.82
R7989:Tiam2	UTSW	17	3518249	nonsense	probably null
R8011:Tiam2	UTSW	17	3448396	missense	possibly damaging	0.92
R8221:Tiam2	UTSW	17	3518585	missense	probably damaging	0.99
R8260:Tiam2	UTSW	17	3518319	missense	possibly damaging	0.94
R8292:Tiam2	UTSW	17	3506867	missense	probably benign	0.01
R8406:Tiam2	UTSW	17	3507790	missense	possibly damaging	0.94
R8424:Tiam2	UTSW	17	3516041	missense	probably damaging	1.00
R8424:Tiam2	UTSW	17	3516042	missense	probably damaging	1.00
R8430:Tiam2	UTSW	17	3518262	missense	probably benign	0.05
R8530:Tiam2	UTSW	17	3450812	missense	probably benign	0.03
R8692:Tiam2	UTSW	17	3428807	missense	probably damaging	1.00
R8902:Tiam2	UTSW	17	3477196	missense	probably benign	0.00
R9067:Tiam2	UTSW	17	3511132	missense	probably damaging	1.00
R9080:Tiam2	UTSW	17	3414244	missense	probably benign
R9090:Tiam2	UTSW	17	3414736	missense	probably damaging	1.00
R9211:Tiam2	UTSW	17	3448454	missense	possibly damaging	0.94
R9271:Tiam2	UTSW	17	3414736	missense	probably damaging	1.00
R9347:Tiam2	UTSW	17	3421648	missense	probably benign	0.37
R9353:Tiam2	UTSW	17	3507799	nonsense	probably null
R9407:Tiam2	UTSW	17	3503023	missense	probably damaging	1.00
R9460:Tiam2	UTSW	17	3437310	missense	probably damaging	1.00
R9550:Tiam2	UTSW	17	3509431	missense	probably damaging	1.00
R9748:Tiam2	UTSW	17	3511165	missense	probably benign	0.20
X0027:Tiam2	UTSW	17	3414000	start codon destroyed	probably null	1.00
X0060:Tiam2	UTSW	17	3450354	splice site	probably null
X0065:Tiam2	UTSW	17	3505708	missense	probably damaging	1.00
Z1088:Tiam2	UTSW	17	3415019	missense	probably benign	0.01
Z1176:Tiam2	UTSW	17	3505776	missense	probably null	1.00
Z1177:Tiam2	UTSW	17	3427263	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CATCAGTAAACTCATGGTTTGACC -3'
(R):5'- CTTCATCACTCAGAATGTCGC -3'

Sequencing Primer
(F):5'- AACTCATGGTTTGACCTAAATGGTG -3'
(R):5'- GCTTTCTTTGATAAGACCATCTGG -3'

Posted On

2019-11-26