Incidental Mutation 'R7743:Vmn2r115'
ID 596704
Institutional Source Beutler Lab
Gene Symbol Vmn2r115
Ensembl Gene ENSMUSG00000091076
Gene Name vomeronasal 2, receptor 115
Synonyms EG638102
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock # R7743 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 23343977-23360128 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) C to T at 23345798 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Stop codon at position 220 (Q220*)
Ref Sequence ENSEMBL: ENSMUSP00000131447 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168175]
AlphaFold E9Q0E7
Predicted Effect probably null
Transcript: ENSMUST00000168175
AA Change: Q220*
SMART Domains Protein: ENSMUSP00000131447
Gene: ENSMUSG00000091076
AA Change: Q220*

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 471 1.4e-28 PFAM
Pfam:NCD3G 512 565 2.9e-20 PFAM
Pfam:7tm_3 598 833 5e-55 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 97% (77/79)
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,068,755 E1235G probably damaging Het
Adam6a A G 12: 113,544,532 D175G probably benign Het
Adgrf4 A T 17: 42,672,562 C76* probably null Het
Agbl3 C T 6: 34,846,830 T815I probably damaging Het
Ahnak2 A G 12: 112,784,763 V488A not run Het
Akip1 T A 7: 109,711,828 S192T probably benign Het
Apc2 G A 10: 80,304,915 M201I probably damaging Het
Arel1 G T 12: 84,940,269 N124K probably damaging Het
Atp10a A T 7: 58,803,709 H845L probably damaging Het
Atp2a2 A G 5: 122,461,571 Y586H probably benign Het
BC051019 A G 7: 109,716,059 Y330H probably damaging Het
Btbd11 A T 10: 85,624,949 I569F possibly damaging Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Chek2 T G 5: 110,840,050 probably null Het
Cldn14 A G 16: 93,919,727 L77S probably damaging Het
Cox15 T C 19: 43,739,941 K298E possibly damaging Het
Cpt1b G T 15: 89,421,404 D369E probably benign Het
Cpxm1 T C 2: 130,393,422 N550S probably benign Het
Csdc2 A G 15: 81,949,198 E132G possibly damaging Het
Cyb5d2 A T 11: 72,778,876 C219S probably damaging Het
Erbb4 T C 1: 68,328,119 T480A probably benign Het
Fndc1 G A 17: 7,765,137 T1319I unknown Het
Gm5773 T G 3: 93,773,258 V79G probably damaging Het
Hsf2 G A 10: 57,511,335 probably null Het
Itgb2l T C 16: 96,437,408 T64A probably damaging Het
Kifc5b T C 17: 26,924,202 V316A probably damaging Het
Ktn1 A G 14: 47,670,293 D279G probably damaging Het
Lonrf1 T C 8: 36,249,052 E143G possibly damaging Het
Mroh9 C T 1: 163,024,553 E856K probably benign Het
Muc16 T C 9: 18,657,477 T1249A unknown Het
Myh6 G A 14: 54,957,150 R721W probably damaging Het
Myo6 A T 9: 80,276,329 I669F unknown Het
N4bp2 A G 5: 65,808,459 T1284A probably damaging Het
Npr3 A G 15: 11,905,638 M1T probably null Het
Obscn C T 11: 59,099,777 V1657M probably damaging Het
Olfr243 A G 7: 103,717,353 E253G possibly damaging Het
Olfr551 A T 7: 102,588,431 F104Y probably benign Het
Olfr908 A G 9: 38,516,328 T99A possibly damaging Het
Otud6b C A 4: 14,818,389 A171S possibly damaging Het
Pdcd2l A C 7: 34,192,831 D204E probably benign Het
Pdia2 T C 17: 26,198,868 S56G probably benign Het
Plcxd1 G A 5: 110,102,503 E237K possibly damaging Het
Plekha5 A T 6: 140,555,986 R633S probably damaging Het
Pnpla6 T C 8: 3,536,594 F937L possibly damaging Het
Pth2 A T 7: 45,181,309 M6L probably benign Het
Ptprd T A 4: 76,086,089 K143I probably damaging Het
Rhbdf2 T C 11: 116,601,601 D487G probably benign Het
Rhbdf2 A T 11: 116,603,949 D300E probably benign Het
Rock2 G A 12: 16,976,047 V1265I probably damaging Het
Rsf1 CGGC CGGCGGCGGAGGC 7: 97,579,932 probably benign Het
Rtn4 T A 11: 29,733,790 Y1027* probably null Het
Rxfp3 A G 15: 11,037,130 L52P probably damaging Het
Sel1l3 A G 5: 53,135,885 Y830H probably benign Het
Serpinb3d C T 1: 107,079,358 V207I probably damaging Het
Sipa1l2 T C 8: 125,464,233 E1006G probably damaging Het
Slc22a19 C T 19: 7,683,836 M324I possibly damaging Het
Slc37a1 T A 17: 31,316,185 F106I probably damaging Het
Snx14 A T 9: 88,398,349 S518T probably benign Het
Sp2 T C 11: 96,961,109 T330A probably damaging Het
Spata13 A T 14: 60,756,249 H1050L probably damaging Het
Sptssa A C 12: 54,656,416 V23G possibly damaging Het
Syt3 A T 7: 44,392,667 I317F probably damaging Het
Tars A C 15: 11,399,372 probably null Het
Tead3 T A 17: 28,332,827 T431S probably benign Het
Tiam2 G A 17: 3,518,156 E1526K possibly damaging Het
Tnni3 G A 7: 4,521,892 P12L probably benign Het
Topaz1 A G 9: 122,785,136 H1207R probably benign Het
Trdn G T 10: 33,257,062 E107* probably null Het
Trp63 A G 16: 25,882,625 N483S probably benign Het
Trpm4 A G 7: 45,308,338 S1009P probably benign Het
Trpm6 T C 19: 18,827,408 V908A probably benign Het
Tsen34 A T 7: 3,694,602 M25L possibly damaging Het
Ttn T C 2: 76,951,483 E1073G unknown Het
Uaca A T 9: 60,876,395 I1380F probably damaging Het
Ubr3 A G 2: 69,944,449 T539A probably benign Het
Ugt1a5 T A 1: 88,166,395 M115K probably benign Het
Unc45b A T 11: 82,922,900 I378F probably damaging Het
Unk G A 11: 116,049,436 R205Q possibly damaging Het
Ush2a T A 1: 188,810,179 L3314Q probably benign Het
Vezt A G 10: 93,980,424 L475P probably damaging Het
Yap1 T C 9: 7,962,378 Q223R probably benign Het
Zdhhc7 G A 8: 120,086,728 T114M possibly damaging Het
Zwilch A C 9: 64,152,935 C374G probably damaging Het
Other mutations in Vmn2r115
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Vmn2r115 APN 17 23346206 missense possibly damaging 0.90
IGL00990:Vmn2r115 APN 17 23346176 missense probably benign 0.00
IGL00990:Vmn2r115 APN 17 23359349 missense probably benign 0.22
IGL00990:Vmn2r115 APN 17 23346339 missense probably damaging 1.00
IGL00990:Vmn2r115 APN 17 23346278 missense probably benign 0.14
IGL00990:Vmn2r115 APN 17 23346161 missense probably benign 0.03
IGL00990:Vmn2r115 APN 17 23359397 missense probably damaging 1.00
IGL00990:Vmn2r115 APN 17 23346371 nonsense probably null
IGL00990:Vmn2r115 APN 17 23346372 missense probably benign 0.30
IGL00990:Vmn2r115 APN 17 23356960 missense probably benign 0.00
IGL00990:Vmn2r115 APN 17 23346264 missense probably benign 0.19
IGL00990:Vmn2r115 APN 17 23359779 missense probably damaging 1.00
IGL00990:Vmn2r115 APN 17 23359824 missense probably damaging 1.00
IGL00990:Vmn2r115 APN 17 23348034 nonsense probably null
IGL01073:Vmn2r115 APN 17 23345997 missense probably benign 0.12
IGL01101:Vmn2r115 APN 17 23345997 missense probably benign 0.12
IGL01300:Vmn2r115 APN 17 23359781 missense probably damaging 1.00
IGL01415:Vmn2r115 APN 17 23359781 missense probably damaging 1.00
IGL02309:Vmn2r115 APN 17 23345139 missense probably benign 0.01
IGL02863:Vmn2r115 APN 17 23359283 missense probably damaging 0.97
R0023:Vmn2r115 UTSW 17 23346278 missense probably benign 0.14
R0197:Vmn2r115 UTSW 17 23359781 missense probably damaging 1.00
R0361:Vmn2r115 UTSW 17 23345222 missense probably benign 0.11
R0601:Vmn2r115 UTSW 17 23360100 missense probably null 0.51
R0676:Vmn2r115 UTSW 17 23346264 missense probably benign 0.19
R0685:Vmn2r115 UTSW 17 23359275 missense probably benign
R0865:Vmn2r115 UTSW 17 23346408 missense possibly damaging 0.65
R1124:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1145:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1146:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1207:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1266:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1318:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1367:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1376:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1376:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1420:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1469:Vmn2r115 UTSW 17 23346018 missense probably damaging 0.99
R1469:Vmn2r115 UTSW 17 23346018 missense probably damaging 0.99
R1604:Vmn2r115 UTSW 17 23345271 missense probably benign 0.12
R1645:Vmn2r115 UTSW 17 23346218 missense possibly damaging 0.69
R1646:Vmn2r115 UTSW 17 23359539 missense probably damaging 1.00
R1650:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1678:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1716:Vmn2r115 UTSW 17 23347821 missense probably benign
R1846:Vmn2r115 UTSW 17 23359383 missense probably damaging 1.00
R1847:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1885:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1887:Vmn2r115 UTSW 17 23346033 missense possibly damaging 0.91
R1937:Vmn2r115 UTSW 17 23359414 missense probably damaging 1.00
R2007:Vmn2r115 UTSW 17 23347953 missense possibly damaging 0.94
R2120:Vmn2r115 UTSW 17 23359323 missense probably damaging 1.00
R3161:Vmn2r115 UTSW 17 23357024 missense possibly damaging 0.82
R3780:Vmn2r115 UTSW 17 23345172 missense probably damaging 1.00
R3806:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R3982:Vmn2r115 UTSW 17 23359974 missense probably damaging 1.00
R4019:Vmn2r115 UTSW 17 23360043 missense probably damaging 1.00
R4039:Vmn2r115 UTSW 17 23345103 missense probably benign 0.26
R4087:Vmn2r115 UTSW 17 23346384 missense probably benign 0.35
R4089:Vmn2r115 UTSW 17 23346384 missense probably benign 0.35
R4379:Vmn2r115 UTSW 17 23345223 missense possibly damaging 0.95
R4417:Vmn2r115 UTSW 17 23345880 missense probably benign 0.02
R4601:Vmn2r115 UTSW 17 23346399 missense probably benign 0.01
R4874:Vmn2r115 UTSW 17 23359851 missense probably damaging 1.00
R5466:Vmn2r115 UTSW 17 23360056 missense probably damaging 1.00
R5613:Vmn2r115 UTSW 17 23345333 missense probably benign
R5821:Vmn2r115 UTSW 17 23347963 missense probably damaging 0.99
R6120:Vmn2r115 UTSW 17 23346029 missense probably damaging 1.00
R6193:Vmn2r115 UTSW 17 23357009 missense probably benign 0.01
R6213:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R6290:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R6319:Vmn2r115 UTSW 17 23347903 missense possibly damaging 0.70
R6495:Vmn2r115 UTSW 17 23359598 missense probably benign 0.02
R6599:Vmn2r115 UTSW 17 23346032 missense probably benign 0.00
R6764:Vmn2r115 UTSW 17 23346072 missense probably damaging 1.00
R6970:Vmn2r115 UTSW 17 23346015 missense probably benign 0.23
R7023:Vmn2r115 UTSW 17 23359811 missense probably damaging 1.00
R7236:Vmn2r115 UTSW 17 23359602 missense probably benign 0.01
R7353:Vmn2r115 UTSW 17 23345913 missense possibly damaging 0.65
R7483:Vmn2r115 UTSW 17 23346397 missense possibly damaging 0.95
R8005:Vmn2r115 UTSW 17 23344150 nonsense probably null
R8191:Vmn2r115 UTSW 17 23359556 missense probably damaging 1.00
R8544:Vmn2r115 UTSW 17 23345799 missense possibly damaging 0.88
R8890:Vmn2r115 UTSW 17 23359523 missense probably damaging 0.98
R9098:Vmn2r115 UTSW 17 23345829 missense probably benign
R9114:Vmn2r115 UTSW 17 23345333 missense probably benign
R9189:Vmn2r115 UTSW 17 23345810 missense probably damaging 1.00
R9351:Vmn2r115 UTSW 17 23359508 missense probably benign 0.05
R9397:Vmn2r115 UTSW 17 23345178 nonsense probably null
R9410:Vmn2r115 UTSW 17 23359941 missense possibly damaging 0.67
V5622:Vmn2r115 UTSW 17 23346227 missense probably damaging 1.00
V5622:Vmn2r115 UTSW 17 23359359 missense probably benign
X0023:Vmn2r115 UTSW 17 23359988 small deletion probably benign
X0033:Vmn2r115 UTSW 17 23359988 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- AGAATTCATTGTACCTTGTGCTGG -3'
(R):5'- ACCAGGACTGACATTCCACTG -3'

Sequencing Primer
(F):5'- ACCTTGTGCTGGTTCCTGATTTCTAG -3'
(R):5'- ACTGACATTCCACTGTGAGG -3'
Posted On 2019-11-26