Incidental Mutation 'R7743:Trpm6'
ID 596711
Institutional Source Beutler Lab
Gene Symbol Trpm6
Ensembl Gene ENSMUSG00000024727
Gene Name transient receptor potential cation channel, subfamily M, member 6
Synonyms CHAK2
MMRRC Submission 045799-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7743 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 18727347-18869875 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 18804772 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 908 (V908A)
Ref Sequence ENSEMBL: ENSMUSP00000037443 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040489]
AlphaFold Q8CIR4
Predicted Effect probably benign
Transcript: ENSMUST00000040489
AA Change: V908A

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000037443
Gene: ENSMUSG00000024727
AA Change: V908A

DomainStartEndE-ValueType
Blast:ANK 430 459 4e-8 BLAST
low complexity region 580 604 N/A INTRINSIC
transmembrane domain 749 766 N/A INTRINSIC
Pfam:Ion_trans 847 1087 2.8e-13 PFAM
low complexity region 1113 1126 N/A INTRINSIC
low complexity region 1136 1154 N/A INTRINSIC
Pfam:TRPM_tetra 1176 1231 7.5e-27 PFAM
low complexity region 1320 1331 N/A INTRINSIC
low complexity region 1578 1596 N/A INTRINSIC
Blast:Alpha_kinase 1618 1673 9e-11 BLAST
low complexity region 1682 1695 N/A INTRINSIC
Alpha_kinase 1761 1978 1e-84 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 97% (77/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is predominantly expressed in the kidney and colon, and encodes a protein containing an ion channel domain and a protein kinase domain. It is crucial for magnesium homeostasis, and plays an essential role in epithelial magnesium transport and in the active magnesium absorption in the gut and kidney. Mutations in this gene are associated with hypomagnesemia with secondary hypocalcemia. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic and postnatal lethality with exencephaly, spina bifida occulta, and abnormal brain and facial development. Mice heterozygous for a knock-out allele exhibit some premature death and decreased serummagnesium. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 137,774,516 (GRCm39) E1235G probably damaging Het
Abtb3 A T 10: 85,460,813 (GRCm39) I569F possibly damaging Het
Adam6a A G 12: 113,508,152 (GRCm39) D175G probably benign Het
Adgrf4 A T 17: 42,983,453 (GRCm39) C76* probably null Het
Agbl3 C T 6: 34,823,765 (GRCm39) T815I probably damaging Het
Ahnak2 A G 12: 112,748,383 (GRCm39) V488A not run Het
Akip1 T A 7: 109,311,035 (GRCm39) S192T probably benign Het
Apc2 G A 10: 80,140,749 (GRCm39) M201I probably damaging Het
Arel1 G T 12: 84,987,043 (GRCm39) N124K probably damaging Het
Atp10a A T 7: 58,453,457 (GRCm39) H845L probably damaging Het
Atp2a2 A G 5: 122,599,634 (GRCm39) Y586H probably benign Het
BC051019 A G 7: 109,315,266 (GRCm39) Y330H probably damaging Het
Ccng2 C G 5: 93,421,202 (GRCm39) S237R probably benign Het
Chek2 T G 5: 110,987,916 (GRCm39) probably null Het
Cldn14 A G 16: 93,716,615 (GRCm39) L77S probably damaging Het
Cox15 T C 19: 43,728,380 (GRCm39) K298E possibly damaging Het
Cpt1b G T 15: 89,305,607 (GRCm39) D369E probably benign Het
Cpxm1 T C 2: 130,235,342 (GRCm39) N550S probably benign Het
Csdc2 A G 15: 81,833,399 (GRCm39) E132G possibly damaging Het
Cyb5d2 A T 11: 72,669,702 (GRCm39) C219S probably damaging Het
Erbb4 T C 1: 68,367,278 (GRCm39) T480A probably benign Het
Fndc1 G A 17: 7,983,969 (GRCm39) T1319I unknown Het
Gm5773 T G 3: 93,680,565 (GRCm39) V79G probably damaging Het
Hsf2 G A 10: 57,387,431 (GRCm39) probably null Het
Itgb2l T C 16: 96,238,608 (GRCm39) T64A probably damaging Het
Kifc5b T C 17: 27,143,176 (GRCm39) V316A probably damaging Het
Ktn1 A G 14: 47,907,750 (GRCm39) D279G probably damaging Het
Lonrf1 T C 8: 36,716,206 (GRCm39) E143G possibly damaging Het
Mroh9 C T 1: 162,852,122 (GRCm39) E856K probably benign Het
Muc16 T C 9: 18,568,773 (GRCm39) T1249A unknown Het
Myh6 G A 14: 55,194,607 (GRCm39) R721W probably damaging Het
Myo6 A T 9: 80,183,611 (GRCm39) I669F unknown Het
N4bp2 A G 5: 65,965,802 (GRCm39) T1284A probably damaging Het
Npr3 A G 15: 11,905,724 (GRCm39) M1T probably null Het
Obscn C T 11: 58,990,603 (GRCm39) V1657M probably damaging Het
Olfr908 A G 9: 38,427,624 (GRCm39) T99A possibly damaging Het
Or52a20 A G 7: 103,366,560 (GRCm39) E253G possibly damaging Het
Or52p2 A T 7: 102,237,638 (GRCm39) F104Y probably benign Het
Otud6b C A 4: 14,818,389 (GRCm39) A171S possibly damaging Het
Pdcd2l A C 7: 33,892,256 (GRCm39) D204E probably benign Het
Pdia2 T C 17: 26,417,842 (GRCm39) S56G probably benign Het
Plcxd1 G A 5: 110,250,369 (GRCm39) E237K possibly damaging Het
Plekha5 A T 6: 140,501,712 (GRCm39) R633S probably damaging Het
Pnpla6 T C 8: 3,586,594 (GRCm39) F937L possibly damaging Het
Pth2 A T 7: 44,830,733 (GRCm39) M6L probably benign Het
Ptprd T A 4: 76,004,326 (GRCm39) K143I probably damaging Het
Rhbdf2 T C 11: 116,492,427 (GRCm39) D487G probably benign Het
Rhbdf2 A T 11: 116,494,775 (GRCm39) D300E probably benign Het
Rock2 G A 12: 17,026,048 (GRCm39) V1265I probably damaging Het
Rsf1 CGGC CGGCGGCGGAGGC 7: 97,229,139 (GRCm39) probably benign Het
Rtn4 T A 11: 29,683,790 (GRCm39) Y1027* probably null Het
Rxfp3 A G 15: 11,037,216 (GRCm39) L52P probably damaging Het
Sel1l3 A G 5: 53,293,227 (GRCm39) Y830H probably benign Het
Serpinb3d C T 1: 107,007,088 (GRCm39) V207I probably damaging Het
Sipa1l2 T C 8: 126,190,972 (GRCm39) E1006G probably damaging Het
Slc22a19 C T 19: 7,661,201 (GRCm39) M324I possibly damaging Het
Slc37a1 T A 17: 31,535,159 (GRCm39) F106I probably damaging Het
Snx14 A T 9: 88,280,402 (GRCm39) S518T probably benign Het
Sp2 T C 11: 96,851,935 (GRCm39) T330A probably damaging Het
Spata13 A T 14: 60,993,698 (GRCm39) H1050L probably damaging Het
Sptssa A C 12: 54,703,201 (GRCm39) V23G possibly damaging Het
Syt3 A T 7: 44,042,091 (GRCm39) I317F probably damaging Het
Tars1 A C 15: 11,399,458 (GRCm39) probably null Het
Tead3 T A 17: 28,551,801 (GRCm39) T431S probably benign Het
Tiam2 G A 17: 3,568,431 (GRCm39) E1526K possibly damaging Het
Tnni3 G A 7: 4,524,891 (GRCm39) P12L probably benign Het
Topaz1 A G 9: 122,614,201 (GRCm39) H1207R probably benign Het
Trdn G T 10: 33,133,058 (GRCm39) E107* probably null Het
Trp63 A G 16: 25,701,375 (GRCm39) N483S probably benign Het
Trpm4 A G 7: 44,957,762 (GRCm39) S1009P probably benign Het
Tsen34 A T 7: 3,697,601 (GRCm39) M25L possibly damaging Het
Ttn T C 2: 76,781,827 (GRCm39) E1073G unknown Het
Uaca A T 9: 60,783,677 (GRCm39) I1380F probably damaging Het
Ubr3 A G 2: 69,774,793 (GRCm39) T539A probably benign Het
Ugt1a5 T A 1: 88,094,117 (GRCm39) M115K probably benign Het
Unc45b A T 11: 82,813,726 (GRCm39) I378F probably damaging Het
Unk G A 11: 115,940,262 (GRCm39) R205Q possibly damaging Het
Ush2a T A 1: 188,542,376 (GRCm39) L3314Q probably benign Het
Vezt A G 10: 93,816,286 (GRCm39) L475P probably damaging Het
Vmn2r115 C T 17: 23,564,772 (GRCm39) Q220* probably null Het
Yap1 T C 9: 7,962,379 (GRCm39) Q223R probably benign Het
Zdhhc7 G A 8: 120,813,467 (GRCm39) T114M possibly damaging Het
Zwilch A C 9: 64,060,217 (GRCm39) C374G probably damaging Het
Other mutations in Trpm6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:Trpm6 APN 19 18,761,272 (GRCm39) splice site probably benign
IGL00862:Trpm6 APN 19 18,804,892 (GRCm39) missense probably damaging 1.00
IGL01348:Trpm6 APN 19 18,855,015 (GRCm39) missense probably damaging 1.00
IGL01400:Trpm6 APN 19 18,803,158 (GRCm39) nonsense probably null
IGL01451:Trpm6 APN 19 18,786,933 (GRCm39) missense probably damaging 1.00
IGL01508:Trpm6 APN 19 18,773,894 (GRCm39) nonsense probably null
IGL01995:Trpm6 APN 19 18,807,691 (GRCm39) splice site probably benign
IGL02092:Trpm6 APN 19 18,749,695 (GRCm39) missense possibly damaging 0.59
IGL02152:Trpm6 APN 19 18,809,903 (GRCm39) missense possibly damaging 0.93
IGL02294:Trpm6 APN 19 18,831,427 (GRCm39) missense probably benign
IGL02329:Trpm6 APN 19 18,831,581 (GRCm39) missense probably benign 0.17
IGL02366:Trpm6 APN 19 18,755,874 (GRCm39) splice site probably benign
IGL02402:Trpm6 APN 19 18,764,120 (GRCm39) missense probably benign 0.18
IGL02457:Trpm6 APN 19 18,804,762 (GRCm39) nonsense probably null
IGL02457:Trpm6 APN 19 18,803,155 (GRCm39) missense probably damaging 1.00
IGL02684:Trpm6 APN 19 18,779,571 (GRCm39) splice site probably benign
IGL02705:Trpm6 APN 19 18,754,097 (GRCm39) critical splice donor site probably null
IGL02728:Trpm6 APN 19 18,787,016 (GRCm39) missense possibly damaging 0.71
IGL02742:Trpm6 APN 19 18,807,376 (GRCm39) splice site probably benign
IGL02818:Trpm6 APN 19 18,843,621 (GRCm39) missense probably benign 0.04
IGL02836:Trpm6 APN 19 18,790,846 (GRCm39) missense probably damaging 1.00
IGL03119:Trpm6 APN 19 18,815,381 (GRCm39) nonsense probably null
IGL03193:Trpm6 APN 19 18,803,236 (GRCm39) missense possibly damaging 0.94
IGL03227:Trpm6 APN 19 18,764,143 (GRCm39) missense probably benign 0.12
IGL03227:Trpm6 APN 19 18,796,483 (GRCm39) missense probably benign 0.01
IGL03231:Trpm6 APN 19 18,796,545 (GRCm39) missense probably benign
IGL03245:Trpm6 APN 19 18,855,065 (GRCm39) missense probably damaging 1.00
IGL03328:Trpm6 APN 19 18,815,446 (GRCm39) missense possibly damaging 0.94
IGL03341:Trpm6 APN 19 18,790,850 (GRCm39) missense probably benign
P0043:Trpm6 UTSW 19 18,855,129 (GRCm39) missense probably damaging 1.00
PIT4260001:Trpm6 UTSW 19 18,803,166 (GRCm39) missense possibly damaging 0.48
R0057:Trpm6 UTSW 19 18,764,119 (GRCm39) missense probably benign 0.05
R0115:Trpm6 UTSW 19 18,807,316 (GRCm39) missense probably damaging 0.98
R0119:Trpm6 UTSW 19 18,809,957 (GRCm39) missense probably benign 0.05
R0140:Trpm6 UTSW 19 18,796,558 (GRCm39) splice site probably null
R0267:Trpm6 UTSW 19 18,800,742 (GRCm39) missense probably benign
R0350:Trpm6 UTSW 19 18,861,321 (GRCm39) splice site probably null
R0373:Trpm6 UTSW 19 18,830,951 (GRCm39) missense probably benign 0.15
R0393:Trpm6 UTSW 19 18,756,008 (GRCm39) missense probably damaging 0.99
R0416:Trpm6 UTSW 19 18,760,389 (GRCm39) splice site probably benign
R0505:Trpm6 UTSW 19 18,851,266 (GRCm39) splice site probably benign
R0526:Trpm6 UTSW 19 18,770,240 (GRCm39) missense probably damaging 0.97
R0607:Trpm6 UTSW 19 18,849,585 (GRCm39) missense probably benign 0.00
R0609:Trpm6 UTSW 19 18,803,226 (GRCm39) missense probably damaging 0.97
R0714:Trpm6 UTSW 19 18,815,451 (GRCm39) missense possibly damaging 0.90
R1215:Trpm6 UTSW 19 18,773,862 (GRCm39) missense probably damaging 1.00
R1474:Trpm6 UTSW 19 18,773,859 (GRCm39) missense probably benign 0.28
R1512:Trpm6 UTSW 19 18,853,295 (GRCm39) missense probably benign
R1558:Trpm6 UTSW 19 18,764,192 (GRCm39) missense probably benign 0.04
R1597:Trpm6 UTSW 19 18,804,888 (GRCm39) missense probably damaging 0.98
R1618:Trpm6 UTSW 19 18,854,995 (GRCm39) missense possibly damaging 0.88
R1779:Trpm6 UTSW 19 18,833,581 (GRCm39) missense probably damaging 1.00
R1796:Trpm6 UTSW 19 18,804,931 (GRCm39) missense possibly damaging 0.90
R1799:Trpm6 UTSW 19 18,869,363 (GRCm39) splice site probably null
R1840:Trpm6 UTSW 19 18,843,631 (GRCm39) missense probably benign 0.21
R1991:Trpm6 UTSW 19 18,773,648 (GRCm39) missense probably benign 0.00
R2030:Trpm6 UTSW 19 18,831,629 (GRCm39) missense probably benign
R2073:Trpm6 UTSW 19 18,853,406 (GRCm39) missense probably damaging 1.00
R2074:Trpm6 UTSW 19 18,855,103 (GRCm39) missense probably damaging 1.00
R2096:Trpm6 UTSW 19 18,803,116 (GRCm39) missense probably damaging 0.97
R2103:Trpm6 UTSW 19 18,773,648 (GRCm39) missense probably benign 0.00
R2106:Trpm6 UTSW 19 18,790,714 (GRCm39) missense possibly damaging 0.95
R2117:Trpm6 UTSW 19 18,807,316 (GRCm39) missense probably damaging 0.98
R2850:Trpm6 UTSW 19 18,769,454 (GRCm39) missense possibly damaging 0.68
R3125:Trpm6 UTSW 19 18,831,795 (GRCm39) missense probably benign 0.05
R3719:Trpm6 UTSW 19 18,749,757 (GRCm39) nonsense probably null
R3779:Trpm6 UTSW 19 18,853,403 (GRCm39) missense possibly damaging 0.80
R4115:Trpm6 UTSW 19 18,809,921 (GRCm39) missense probably damaging 1.00
R4367:Trpm6 UTSW 19 18,804,889 (GRCm39) missense probably damaging 0.99
R4523:Trpm6 UTSW 19 18,773,864 (GRCm39) missense probably damaging 1.00
R4546:Trpm6 UTSW 19 18,809,841 (GRCm39) missense probably damaging 1.00
R4564:Trpm6 UTSW 19 18,809,961 (GRCm39) missense possibly damaging 0.95
R4565:Trpm6 UTSW 19 18,803,236 (GRCm39) missense probably damaging 1.00
R4697:Trpm6 UTSW 19 18,831,155 (GRCm39) missense probably benign 0.01
R4714:Trpm6 UTSW 19 18,831,564 (GRCm39) missense possibly damaging 0.93
R4750:Trpm6 UTSW 19 18,853,428 (GRCm39) missense probably damaging 0.99
R4771:Trpm6 UTSW 19 18,790,857 (GRCm39) missense probably damaging 0.97
R4791:Trpm6 UTSW 19 18,845,345 (GRCm39) missense probably benign 0.00
R4814:Trpm6 UTSW 19 18,839,576 (GRCm39) missense probably benign 0.11
R5028:Trpm6 UTSW 19 18,764,124 (GRCm39) missense probably damaging 1.00
R5237:Trpm6 UTSW 19 18,790,828 (GRCm39) missense probably damaging 1.00
R5615:Trpm6 UTSW 19 18,807,297 (GRCm39) missense probably damaging 0.96
R5642:Trpm6 UTSW 19 18,807,571 (GRCm39) missense probably damaging 1.00
R5645:Trpm6 UTSW 19 18,830,968 (GRCm39) missense probably damaging 1.00
R5726:Trpm6 UTSW 19 18,830,981 (GRCm39) missense probably damaging 1.00
R5832:Trpm6 UTSW 19 18,764,183 (GRCm39) missense possibly damaging 0.66
R5843:Trpm6 UTSW 19 18,833,539 (GRCm39) missense probably benign 0.04
R5955:Trpm6 UTSW 19 18,869,383 (GRCm39) missense possibly damaging 0.75
R6101:Trpm6 UTSW 19 18,831,112 (GRCm39) nonsense probably null
R6105:Trpm6 UTSW 19 18,831,112 (GRCm39) nonsense probably null
R6211:Trpm6 UTSW 19 18,760,492 (GRCm39) missense probably damaging 1.00
R6228:Trpm6 UTSW 19 18,831,655 (GRCm39) missense probably damaging 1.00
R6263:Trpm6 UTSW 19 18,831,472 (GRCm39) missense possibly damaging 0.94
R6453:Trpm6 UTSW 19 18,807,354 (GRCm39) missense probably damaging 1.00
R6562:Trpm6 UTSW 19 18,815,406 (GRCm39) missense probably damaging 1.00
R6624:Trpm6 UTSW 19 18,866,384 (GRCm39) missense probably damaging 1.00
R6624:Trpm6 UTSW 19 18,773,803 (GRCm39) critical splice acceptor site probably null
R6729:Trpm6 UTSW 19 18,807,661 (GRCm39) missense probably damaging 1.00
R6765:Trpm6 UTSW 19 18,855,129 (GRCm39) missense probably damaging 1.00
R6976:Trpm6 UTSW 19 18,760,527 (GRCm39) missense probably benign
R7103:Trpm6 UTSW 19 18,790,911 (GRCm39) missense possibly damaging 0.87
R7126:Trpm6 UTSW 19 18,831,397 (GRCm39) nonsense probably null
R7128:Trpm6 UTSW 19 18,789,137 (GRCm39) missense possibly damaging 0.92
R7157:Trpm6 UTSW 19 18,815,462 (GRCm39) missense possibly damaging 0.91
R7212:Trpm6 UTSW 19 18,831,155 (GRCm39) missense probably benign 0.01
R7263:Trpm6 UTSW 19 18,854,150 (GRCm39) missense probably damaging 1.00
R7268:Trpm6 UTSW 19 18,755,949 (GRCm39) missense probably benign 0.13
R7305:Trpm6 UTSW 19 18,853,455 (GRCm39) missense probably benign 0.30
R7498:Trpm6 UTSW 19 18,853,484 (GRCm39) missense probably damaging 1.00
R7558:Trpm6 UTSW 19 18,756,029 (GRCm39) missense probably damaging 0.96
R7590:Trpm6 UTSW 19 18,809,945 (GRCm39) missense probably benign 0.31
R7646:Trpm6 UTSW 19 18,845,325 (GRCm39) missense probably benign 0.10
R7650:Trpm6 UTSW 19 18,853,377 (GRCm39) missense possibly damaging 0.70
R7727:Trpm6 UTSW 19 18,831,613 (GRCm39) missense probably damaging 0.97
R7747:Trpm6 UTSW 19 18,727,409 (GRCm39) splice site probably null
R7807:Trpm6 UTSW 19 18,807,220 (GRCm39) missense probably benign 0.11
R7870:Trpm6 UTSW 19 18,792,605 (GRCm39) missense probably benign 0.01
R7891:Trpm6 UTSW 19 18,754,074 (GRCm39) missense probably benign 0.01
R7955:Trpm6 UTSW 19 18,831,654 (GRCm39) missense probably benign 0.01
R7965:Trpm6 UTSW 19 18,853,474 (GRCm39) missense probably damaging 1.00
R7967:Trpm6 UTSW 19 18,756,023 (GRCm39) missense probably damaging 0.99
R7992:Trpm6 UTSW 19 18,792,714 (GRCm39) missense probably damaging 1.00
R8035:Trpm6 UTSW 19 18,770,226 (GRCm39) missense probably damaging 0.97
R8108:Trpm6 UTSW 19 18,789,154 (GRCm39) missense probably damaging 1.00
R8268:Trpm6 UTSW 19 18,851,225 (GRCm39) missense possibly damaging 0.85
R8411:Trpm6 UTSW 19 18,831,332 (GRCm39) missense probably benign 0.39
R8413:Trpm6 UTSW 19 18,809,849 (GRCm39) missense probably benign 0.00
R8534:Trpm6 UTSW 19 18,869,459 (GRCm39) missense probably benign 0.00
R8932:Trpm6 UTSW 19 18,815,366 (GRCm39) missense possibly damaging 0.87
R8990:Trpm6 UTSW 19 18,792,799 (GRCm39) missense probably damaging 1.00
R9403:Trpm6 UTSW 19 18,810,016 (GRCm39) missense possibly damaging 0.84
R9446:Trpm6 UTSW 19 18,815,462 (GRCm39) missense possibly damaging 0.91
R9463:Trpm6 UTSW 19 18,761,264 (GRCm39) critical splice donor site probably null
R9485:Trpm6 UTSW 19 18,755,978 (GRCm39) missense probably benign 0.06
R9536:Trpm6 UTSW 19 18,764,123 (GRCm39) missense probably damaging 1.00
R9549:Trpm6 UTSW 19 18,853,394 (GRCm39) nonsense probably null
R9564:Trpm6 UTSW 19 18,851,240 (GRCm39) missense possibly damaging 0.92
R9626:Trpm6 UTSW 19 18,790,846 (GRCm39) missense probably damaging 1.00
R9655:Trpm6 UTSW 19 18,869,466 (GRCm39) missense probably benign
R9721:Trpm6 UTSW 19 18,807,336 (GRCm39) missense probably benign 0.12
R9742:Trpm6 UTSW 19 18,800,766 (GRCm39) missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- TCCATGATTCTCAGATCGGC -3'
(R):5'- AGCAAAGAAGTCCATGAGCC -3'

Sequencing Primer
(F):5'- TACGGGTTTGAGGACCGAC -3'
(R):5'- GCCGAGAAAACCAAAATATGATGTC -3'
Posted On 2019-11-26