Incidental Mutation 'R7744:Plbd1'
ID596734
Institutional Source Beutler Lab
Gene Symbol Plbd1
Ensembl Gene ENSMUSG00000030214
Gene Namephospholipase B domain containing 1
Synonyms1100001H23Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7744 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location136612070-136661928 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 136617246 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 335 (E335G)
Ref Sequence ENSEMBL: ENSMUSP00000032336 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032336]
Predicted Effect probably benign
Transcript: ENSMUST00000032336
AA Change: E335G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000032336
Gene: ENSMUSG00000030214
AA Change: E335G

DomainStartEndE-ValueType
Pfam:Phospholip_B 16 545 3.7e-198 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: No abnormal phenotype was observed in a high-throughput screen, nor in a pathology assessment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,290,421 N761K possibly damaging Het
Abi2 A G 1: 60,437,203 I145V probably benign Het
Ampd2 C A 3: 108,080,116 V134L probably benign Het
Atf7ip2 T A 16: 10,241,658 V354E possibly damaging Het
Bglap T C 3: 88,383,651 Y91C probably damaging Het
Cacna1e A T 1: 154,465,792 S1219T probably damaging Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Cd177 A G 7: 24,750,375 C562R probably damaging Het
Cfap57 C T 4: 118,614,931 V84I not run Het
Dyrk3 A G 1: 131,129,806 V210A probably damaging Het
Eif3c C A 7: 126,558,894 G297W probably damaging Het
Eml1 A G 12: 108,516,604 H494R probably benign Het
Fbxw21 C A 9: 109,157,652 C53F possibly damaging Het
Fndc3a C A 14: 72,561,716 G609V possibly damaging Het
Grid1 A G 14: 35,450,079 D514G probably damaging Het
Gxylt2 T C 6: 100,783,317 V271A probably damaging Het
Hes1 A G 16: 30,066,179 K74R probably damaging Het
Igsf9 A G 1: 172,492,185 N349S probably benign Het
Isx T A 8: 74,873,657 I6N possibly damaging Het
Kcnb1 A T 2: 167,188,331 F98Y probably damaging Het
Kif1b G C 4: 149,237,075 T1129R possibly damaging Het
Klra10 T A 6: 130,272,761 probably null Het
Mcm10 A T 2: 4,991,442 L870Q probably damaging Het
Mettl16 T A 11: 74,803,003 I280K probably benign Het
Mre11a G A 9: 14,809,832 R349Q possibly damaging Het
Mrpl10 C T 11: 97,044,576 T34I probably damaging Het
Muc16 T A 9: 18,585,096 probably null Het
Myt1l T C 12: 29,827,549 C400R unknown Het
Nbr1 C T 11: 101,569,384 T402M probably damaging Het
Ndufs1 A G 1: 63,160,940 M271T possibly damaging Het
Olfr1209 C T 2: 88,909,659 V245I possibly damaging Het
Olfr1494 A G 19: 13,750,055 *316W probably null Het
Olfr562-ps1 G T 7: 102,782,390 V305L probably benign Het
Palm2 T C 4: 57,709,519 S155P probably damaging Het
Pced1a C T 2: 130,422,052 D227N probably damaging Het
Phf21b A G 15: 84,804,869 I152T probably damaging Het
Pla2g4a A G 1: 149,861,102 V430A probably benign Het
Plce1 G A 19: 38,620,455 V403M possibly damaging Het
Pnpla6 T A 8: 3,531,677 N642K probably benign Het
Ptprb T C 10: 116,277,484 I123T probably benign Het
Ranbp3 C T 17: 56,708,219 T307M possibly damaging Het
Rasgrp2 T C 19: 6,405,001 S254P probably damaging Het
Rgl3 T C 9: 21,987,570 K191R probably benign Het
Rnf223 G A 4: 156,132,525 R119H probably benign Het
Sapcd2 C T 2: 25,373,496 P217S unknown Het
Sh3bp1 A C 15: 78,910,009 T526P possibly damaging Het
Slc17a4 C A 13: 23,901,784 W382L probably benign Het
Slc26a3 A T 12: 31,463,465 probably null Het
Tmem129 A G 5: 33,654,388 L356P probably damaging Het
Trib1 T A 15: 59,654,663 Y361N probably benign Het
Xirp1 T A 9: 120,016,846 R990S possibly damaging Het
Other mutations in Plbd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00753:Plbd1 APN 6 136634470 missense probably benign
IGL02131:Plbd1 APN 6 136661683 utr 5 prime probably benign
R0355:Plbd1 UTSW 6 136641167 missense possibly damaging 0.71
R0762:Plbd1 UTSW 6 136641147 missense probably damaging 1.00
R1019:Plbd1 UTSW 6 136651905 missense probably benign 0.03
R1456:Plbd1 UTSW 6 136613816 missense probably benign 0.12
R1607:Plbd1 UTSW 6 136612306 missense probably benign 0.04
R1640:Plbd1 UTSW 6 136640125 missense probably benign 0.00
R2166:Plbd1 UTSW 6 136613790 critical splice donor site probably null
R2909:Plbd1 UTSW 6 136634574 missense probably damaging 1.00
R4494:Plbd1 UTSW 6 136613858 missense probably damaging 1.00
R4529:Plbd1 UTSW 6 136651825 missense probably benign 0.04
R4530:Plbd1 UTSW 6 136651825 missense probably benign 0.04
R5206:Plbd1 UTSW 6 136641156 missense probably benign 0.17
R5272:Plbd1 UTSW 6 136640158 missense probably damaging 1.00
R5522:Plbd1 UTSW 6 136617300 missense probably benign 0.31
R5649:Plbd1 UTSW 6 136616989 missense probably benign 0.01
R5879:Plbd1 UTSW 6 136634505 missense probably damaging 1.00
R5940:Plbd1 UTSW 6 136613721 intron probably benign
R6311:Plbd1 UTSW 6 136613947 missense probably benign 0.09
R6590:Plbd1 UTSW 6 136635600 missense probably damaging 1.00
R6657:Plbd1 UTSW 6 136617252 missense probably damaging 0.99
R6690:Plbd1 UTSW 6 136635600 missense probably damaging 1.00
R6842:Plbd1 UTSW 6 136635614 missense probably benign 0.05
R6938:Plbd1 UTSW 6 136616987 missense probably benign 0.00
R7000:Plbd1 UTSW 6 136612838 missense probably benign 0.21
R7214:Plbd1 UTSW 6 136612831 missense probably damaging 1.00
R7654:Plbd1 UTSW 6 136651866 missense possibly damaging 0.47
R7870:Plbd1 UTSW 6 136617328 missense possibly damaging 0.81
R7953:Plbd1 UTSW 6 136617328 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- TCCAGGCTCCTATTGATGGTC -3'
(R):5'- CGATGACCTGTGCGTTTGTC -3'

Sequencing Primer
(F):5'- GTACCTGAAATGTTGGAAGACAC -3'
(R):5'- CTTCTTCTAGGGTTCTTGGAGTCTC -3'
Posted On2019-11-26