Mutagenetix > Incidental Mutation

Incidental Mutation 'R7744:Mre11a'

596740

Institutional Source

Beutler Lab

Gene Symbol

Mre11a

Ensembl Gene

ENSMUSG00000031928

Gene Name

MRE11A homolog A, double strand break repair nuclease

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7744 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

14784654-14837123 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 14809832 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glutamine at position 349 (R349Q)

Ref Sequence

ENSEMBL: ENSMUSP00000034405 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034405] [ENSMUST00000115632]

AlphaFold

Q61216

Predicted Effect

possibly damaging
Transcript: ENSMUST00000034405
AA Change: R349Q

PolyPhen 2 Score 0.943 (Sensitivity: 0.80; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000034405
Gene: ENSMUSG00000031928
AA Change: R349Q

Domain	Start	End	E-Value	Type
Pfam:Metallophos	13	249	6.3e-15	PFAM
Mre11_DNA_bind	294	462	1.72e-70	SMART
coiled coil region	487	519	N/A	INTRINSIC
low complexity region	566	594	N/A	INTRINSIC
low complexity region	683	699	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000115632

SMART Domains

Protein: ENSMUSP00000111295
Gene: ENSMUSG00000031928

Domain	Start	End	E-Value	Type
Pfam:Metallophos	13	249	1.1e-31	PFAM
Mre11_DNA_bind	294	435	7.6e-49	SMART
coiled coil region	460	492	N/A	INTRINSIC
low complexity region	539	567	N/A	INTRINSIC
low complexity region	656	672	N/A	INTRINSIC

Predicted Effect

SMART Domains

Protein: ENSMUSP00000119999
Gene: ENSMUSG00000031928
AA Change: R116Q

Domain	Start	End	E-Value	Type
PDB:3T1I\|D	2	50	3e-26	PDB
Mre11_DNA_bind	62	170	1.81e-32	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (55/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein involved in homologous recombination, telomere length maintenance, and DNA double-strand break repair. By itself, the protein has 3' to 5' exonuclease activity and endonuclease activity. The protein forms a complex with the RAD50 homolog; this complex is required for nonhomologous joining of DNA ends and possesses increased single-stranded DNA endonuclease and 3' to 5' exonuclease activities. In conjunction with a DNA ligase, this protein promotes the joining of noncomplementary ends in vitro using short homologies near the ends of the DNA fragments. This gene has a pseudogene on chromosome 3. Alternative splicing of this gene results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Though mutation of this locus affected chromosome stability, mutant mice were no more susceptible to tumorigenesis than wild-type mice. Mutant female mice showed reduced fertility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	T	A	11: 9,290,421	N761K	possibly damaging	Het
Abi2	A	G	1: 60,437,203	I145V	probably benign	Het
Ampd2	C	A	3: 108,080,116	V134L	probably benign	Het
Atf7ip2	T	A	16: 10,241,658	V354E	possibly damaging	Het
Bglap	T	C	3: 88,383,651	Y91C	probably damaging	Het
Cacna1e	A	T	1: 154,465,792	S1219T	probably damaging	Het
Ccng2	C	G	5: 93,273,343	S237R	probably benign	Het
Cd177	A	G	7: 24,750,375	C562R	probably damaging	Het
Cfap57	C	T	4: 118,614,931	V84I	probably benign	Het
Chd7	T	A	4: 8,862,485		probably null	Het
Dyrk3	A	G	1: 131,129,806	V210A	probably damaging	Het
Eif3c	C	A	7: 126,558,894	G297W	probably damaging	Het
Eml1	A	G	12: 108,516,604	H494R	probably benign	Het
Enpp2	A	T	15: 54,901,233		probably null	Het
Fbxw21	C	A	9: 109,157,652	C53F	possibly damaging	Het
Fndc3a	C	A	14: 72,561,716	G609V	possibly damaging	Het
Grid1	A	G	14: 35,450,079	D514G	probably damaging	Het
Gxylt2	T	C	6: 100,783,317	V271A	probably damaging	Het
Hes1	A	G	16: 30,066,179	K74R	probably damaging	Het
Igsf9	A	G	1: 172,492,185	N349S	probably benign	Het
Isx	T	A	8: 74,873,657	I6N	possibly damaging	Het
Kcnb1	A	T	2: 167,188,331	F98Y	probably damaging	Het
Kif1b	G	C	4: 149,237,075	T1129R	possibly damaging	Het
Klra10	T	A	6: 130,272,761		probably null	Het
Mcm10	A	T	2: 4,991,442	L870Q	probably damaging	Het
Mettl16	T	A	11: 74,803,003	I280K	probably benign	Het
Mrpl10	C	T	11: 97,044,576	T34I	probably damaging	Het
Muc16	T	A	9: 18,585,096		probably null	Het
Myt1l	T	C	12: 29,827,549	C400R	unknown	Het
Nbr1	C	T	11: 101,569,384	T402M	probably damaging	Het
Ndufs1	A	G	1: 63,160,940	M271T	possibly damaging	Het
Olfr1209	C	T	2: 88,909,659	V245I	possibly damaging	Het
Olfr1494	A	G	19: 13,750,055	*316W	probably null	Het
Olfr562-ps1	G	T	7: 102,782,390	V305L	probably benign	Het
Palm2	T	C	4: 57,709,519	S155P	probably damaging	Het
Pced1a	C	T	2: 130,422,052	D227N	probably damaging	Het
Phf21b	A	G	15: 84,804,869	I152T	probably damaging	Het
Pla2g4a	A	G	1: 149,861,102	V430A	probably benign	Het
Plbd1	T	C	6: 136,617,246	E335G	probably benign	Het
Plce1	G	A	19: 38,620,455	V403M	possibly damaging	Het
Pnpla6	T	A	8: 3,531,677	N642K	probably benign	Het
Ptprb	T	C	10: 116,277,484	I123T	probably benign	Het
Rab3il1	T	A	19: 10,028,277		probably null	Het
Ranbp3	C	T	17: 56,708,219	T307M	possibly damaging	Het
Rasgrp2	T	C	19: 6,405,001	S254P	probably damaging	Het
Rgl3	T	C	9: 21,987,570	K191R	probably benign	Het
Rnf223	G	A	4: 156,132,525	R119H	probably benign	Het
Sapcd2	C	T	2: 25,373,496	P217S	unknown	Het
Setd7	C	T	3: 51,526,840		probably null	Het
Sh3bp1	A	C	15: 78,910,009	T526P	possibly damaging	Het
Slc17a4	C	A	13: 23,901,784	W382L	probably benign	Het
Slc26a3	A	T	12: 31,463,465		probably null	Het
Tmem129	A	G	5: 33,654,388	L356P	probably damaging	Het
Trib1	T	A	15: 59,654,663	Y361N	probably benign	Het
Xirp1	T	A	9: 120,016,846	R990S	possibly damaging	Het
Zfp950	A	C	19: 61,127,572		probably null	Het

Other mutations in Mre11a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00156:Mre11a	APN	9	14825208	missense	probably benign	0.28
IGL00429:Mre11a	APN	9	14802813	missense	probably damaging	1.00
IGL00922:Mre11a	APN	9	14799588	missense	probably damaging	1.00
IGL01095:Mre11a	APN	9	14809824	missense	probably benign
IGL01294:Mre11a	APN	9	14830915	missense	probably damaging	0.97
IGL01871:Mre11a	APN	9	14811897	missense	possibly damaging	0.95
IGL02194:Mre11a	APN	9	14815209	missense	possibly damaging	0.70
IGL02213:Mre11a	APN	9	14811884	missense	probably damaging	1.00
IGL02245:Mre11a	APN	9	14815276	unclassified	probably benign
IGL02749:Mre11a	APN	9	14826591	missense	possibly damaging	0.78
IGL02812:Mre11a	APN	9	14790670	splice site	probably null
bow	UTSW	9	14786962	missense	probably damaging	1.00
R0050:Mre11a	UTSW	9	14830973	splice site	probably benign
R0594:Mre11a	UTSW	9	14815209	missense	probably benign	0.00
R1241:Mre11a	UTSW	9	14799639	missense	probably damaging	1.00
R1905:Mre11a	UTSW	9	14799627	missense	probably benign	0.08
R2030:Mre11a	UTSW	9	14795805	missense	probably damaging	1.00
R2270:Mre11a	UTSW	9	14815174	missense	probably benign	0.00
R2511:Mre11a	UTSW	9	14795769	critical splice acceptor site	probably null
R2851:Mre11a	UTSW	9	14826547	missense	probably benign	0.00
R2852:Mre11a	UTSW	9	14826547	missense	probably benign	0.00
R2853:Mre11a	UTSW	9	14826547	missense	probably benign	0.00
R3765:Mre11a	UTSW	9	14809847	missense	probably benign	0.25
R4612:Mre11a	UTSW	9	14802903	missense	probably damaging	1.00
R5007:Mre11a	UTSW	9	14809820	missense	probably benign	0.10
R5343:Mre11a	UTSW	9	14811834	missense	probably damaging	0.98
R5679:Mre11a	UTSW	9	14786919	missense	probably damaging	0.99
R5834:Mre11a	UTSW	9	14799657	missense	probably benign	0.15
R5914:Mre11a	UTSW	9	14811936	missense	probably damaging	1.00
R5935:Mre11a	UTSW	9	14786962	missense	probably damaging	1.00
R6089:Mre11a	UTSW	9	14819464	missense	probably benign	0.02
R6393:Mre11a	UTSW	9	14785509	start codon destroyed	probably null	0.00
R6625:Mre11a	UTSW	9	14805391	missense	possibly damaging	0.52
R7248:Mre11a	UTSW	9	14811913	missense	possibly damaging	0.52
R7999:Mre11a	UTSW	9	14799669	nonsense	probably null
R8179:Mre11a	UTSW	9	14797066	missense	probably null	1.00
R9293:Mre11a	UTSW	9	14799588	missense	probably damaging	1.00
R9302:Mre11a	UTSW	9	14785530	critical splice donor site	probably null
R9368:Mre11a	UTSW	9	14825218	missense	probably benign
R9410:Mre11a	UTSW	9	14805420	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACTGTTAAGGGACGAGGTTG -3'
(R):5'- GTTCACCTGAGATTAGACCAAGCC -3'

Sequencing Primer
(F):5'- TGGTAGGGCCACAAGCTTTAAATG -3'
(R):5'- TGAGATTAGACCAAGCCCACAG -3'

Posted On

2019-11-26