Mutagenetix > Incidental Mutations

Incidental Mutation 'R7744:Muc16'

596741

Institutional Source

Beutler Lab

Gene Symbol

Muc16

Ensembl Gene

ENSMUSG00000109564

Gene Name

mucin 16

Synonyms

1110008I14Rik, LOC385009

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.148) question?

Stock #

R7744 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

18495455-18674530 bp(-) (GRCm38)

Type of Mutation

critical splice acceptor site

DNA Base Change (assembly)

T to A at 18585096 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000147104 (fasta)

Predicted Effect

probably null
Transcript: ENSMUST00000207857

Predicted Effect

probably null
Transcript: ENSMUST00000207857

Predicted Effect

probably null
Transcript: ENSMUST00000208663

Predicted Effect

probably null
Transcript: ENSMUST00000208663

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Homozygous null mice are viable and fertile with no gross histological abnormalities. Homozygous male mice father larger litters when crossed to wild-type females. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	T	A	11: 9,290,421	N761K	possibly damaging	Het
Abi2	A	G	1: 60,437,203	I145V	probably benign	Het
Ampd2	C	A	3: 108,080,116	V134L	probably benign	Het
Atf7ip2	T	A	16: 10,241,658	V354E	possibly damaging	Het
Bglap	T	C	3: 88,383,651	Y91C	probably damaging	Het
Cacna1e	A	T	1: 154,465,792	S1219T	probably damaging	Het
Ccng2	C	G	5: 93,273,343	S237R	probably benign	Het
Cd177	A	G	7: 24,750,375	C562R	probably damaging	Het
Cfap57	C	T	4: 118,614,931	V84I	not run	Het
Dyrk3	A	G	1: 131,129,806	V210A	probably damaging	Het
Eif3c	C	A	7: 126,558,894	G297W	probably damaging	Het
Eml1	A	G	12: 108,516,604	H494R	probably benign	Het
Fbxw21	C	A	9: 109,157,652	C53F	possibly damaging	Het
Fndc3a	C	A	14: 72,561,716	G609V	possibly damaging	Het
Grid1	A	G	14: 35,450,079	D514G	probably damaging	Het
Gxylt2	T	C	6: 100,783,317	V271A	probably damaging	Het
Hes1	A	G	16: 30,066,179	K74R	probably damaging	Het
Igsf9	A	G	1: 172,492,185	N349S	probably benign	Het
Isx	T	A	8: 74,873,657	I6N	possibly damaging	Het
Kcnb1	A	T	2: 167,188,331	F98Y	probably damaging	Het
Kif1b	G	C	4: 149,237,075	T1129R	possibly damaging	Het
Klra10	T	A	6: 130,272,761		probably null	Het
Mcm10	A	T	2: 4,991,442	L870Q	probably damaging	Het
Mettl16	T	A	11: 74,803,003	I280K	probably benign	Het
Mre11a	G	A	9: 14,809,832	R349Q	possibly damaging	Het
Mrpl10	C	T	11: 97,044,576	T34I	probably damaging	Het
Myt1l	T	C	12: 29,827,549	C400R	unknown	Het
Nbr1	C	T	11: 101,569,384	T402M	probably damaging	Het
Ndufs1	A	G	1: 63,160,940	M271T	possibly damaging	Het
Olfr1209	C	T	2: 88,909,659	V245I	possibly damaging	Het
Olfr1494	A	G	19: 13,750,055	*316W	probably null	Het
Olfr562-ps1	G	T	7: 102,782,390	V305L	probably benign	Het
Palm2	T	C	4: 57,709,519	S155P	probably damaging	Het
Pced1a	C	T	2: 130,422,052	D227N	probably damaging	Het
Phf21b	A	G	15: 84,804,869	I152T	probably damaging	Het
Pla2g4a	A	G	1: 149,861,102	V430A	probably benign	Het
Plbd1	T	C	6: 136,617,246	E335G	probably benign	Het
Plce1	G	A	19: 38,620,455	V403M	possibly damaging	Het
Pnpla6	T	A	8: 3,531,677	N642K	probably benign	Het
Ptprb	T	C	10: 116,277,484	I123T	probably benign	Het
Ranbp3	C	T	17: 56,708,219	T307M	possibly damaging	Het
Rasgrp2	T	C	19: 6,405,001	S254P	probably damaging	Het
Rgl3	T	C	9: 21,987,570	K191R	probably benign	Het
Rnf223	G	A	4: 156,132,525	R119H	probably benign	Het
Sapcd2	C	T	2: 25,373,496	P217S	unknown	Het
Sh3bp1	A	C	15: 78,910,009	T526P	possibly damaging	Het
Slc17a4	C	A	13: 23,901,784	W382L	probably benign	Het
Slc26a3	A	T	12: 31,463,465		probably null	Het
Tmem129	A	G	5: 33,654,388	L356P	probably damaging	Het
Trib1	T	A	15: 59,654,663	Y361N	probably benign	Het
Xirp1	T	A	9: 120,016,846	R990S	possibly damaging	Het

Other mutations in Muc16

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01330:Muc16	APN	9	18508507	missense	possibly damaging	0.89
IGL01878:Muc16	APN	9	18495543	missense	possibly damaging	0.90
IGL02394:Muc16	APN	9	18498700	missense	probably damaging	0.99
IGL02553:Muc16	APN	9	18498553	critical splice donor site	probably null
R0400:Muc16	UTSW	9	18510534	missense	possibly damaging	0.74
R1620:Muc16	UTSW	9	18510477	missense	possibly damaging	0.89
R1695:Muc16	UTSW	9	18497433	missense	probably damaging	1.00
R3196:Muc16	UTSW	9	18497830	missense	probably damaging	1.00
R5982:Muc16	UTSW	9	18647146	missense	unknown
R5990:Muc16	UTSW	9	18659243	missense	unknown
R6024:Muc16	UTSW	9	18646671	missense	unknown
R6026:Muc16	UTSW	9	18659858	missense	unknown
R6028:Muc16	UTSW	9	18657176	missense	unknown
R6083:Muc16	UTSW	9	18657212	missense	unknown
R6089:Muc16	UTSW	9	18643252	missense	unknown
R6109:Muc16	UTSW	9	18655359	missense	unknown
R6127:Muc16	UTSW	9	18657878	missense	unknown
R6130:Muc16	UTSW	9	18590698	missense	probably damaging	1.00
R6146:Muc16	UTSW	9	18497797	missense	probably damaging	0.98
R6161:Muc16	UTSW	9	18647818	missense	unknown
R6164:Muc16	UTSW	9	18558379	missense	probably damaging	1.00
R6185:Muc16	UTSW	9	18654473	missense	unknown
R6192:Muc16	UTSW	9	18658689	missense	unknown
R6217:Muc16	UTSW	9	18655446	missense	unknown
R6232:Muc16	UTSW	9	18656998	missense	unknown
R6246:Muc16	UTSW	9	18577067	intron	probably null
R6255:Muc16	UTSW	9	18655599	missense	unknown
R6280:Muc16	UTSW	9	18579317	critical splice donor site	probably null
R6286:Muc16	UTSW	9	18644389	missense	unknown
R6287:Muc16	UTSW	9	18659034	missense	unknown
R6307:Muc16	UTSW	9	18647588	missense	unknown
R6310:Muc16	UTSW	9	18641950	missense	probably benign	0.00
R6316:Muc16	UTSW	9	18641819	missense	probably benign	0.01
R6335:Muc16	UTSW	9	18660708	missense	unknown
R6345:Muc16	UTSW	9	18654926	missense	unknown
R6349:Muc16	UTSW	9	18657329	missense	unknown
R6366:Muc16	UTSW	9	18646044	missense	unknown
R6393:Muc16	UTSW	9	18647399	nonsense	probably null
R6440:Muc16	UTSW	9	18641359	missense	probably benign	0.01
R6458:Muc16	UTSW	9	18641721	missense	probably benign	0.01
R6460:Muc16	UTSW	9	18640516	missense	probably benign	0.01
R6481:Muc16	UTSW	9	18550677	critical splice donor site	probably null
R6539:Muc16	UTSW	9	18637325	missense	probably benign	0.25
R6551:Muc16	UTSW	9	18562562	missense	possibly damaging	0.95
R6596:Muc16	UTSW	9	18566715	missense	probably benign	0.18
R6601:Muc16	UTSW	9	18637570	missense	probably benign	0.10
R6602:Muc16	UTSW	9	18609476	intron	probably null
R6615:Muc16	UTSW	9	18647188	missense	unknown
R6625:Muc16	UTSW	9	18660278	missense	unknown
R6668:Muc16	UTSW	9	18640385	missense	probably benign	0.03
R6697:Muc16	UTSW	9	18641291	missense	probably benign	0.01
R6710:Muc16	UTSW	9	18642070	missense	possibly damaging	0.95
R6727:Muc16	UTSW	9	18566690	critical splice donor site	probably null
R6789:Muc16	UTSW	9	18559986	missense	probably benign	0.40
R6806:Muc16	UTSW	9	18537910	critical splice donor site	probably null
R6874:Muc16	UTSW	9	18658769	nonsense	probably null
R6894:Muc16	UTSW	9	18495576	missense	possibly damaging	0.92
R6913:Muc16	UTSW	9	18642663	missense	unknown
R6919:Muc16	UTSW	9	18660299	missense	unknown
R6939:Muc16	UTSW	9	18638537	missense	probably benign	0.04
R6953:Muc16	UTSW	9	18640529	missense	probably benign	0.01
R6956:Muc16	UTSW	9	18645026	missense	unknown
R6977:Muc16	UTSW	9	18645337	missense	unknown
R6996:Muc16	UTSW	9	18645897	missense	unknown
R7011:Muc16	UTSW	9	18637451	missense	probably benign	0.26
R7011:Muc16	UTSW	9	18637543	missense	probably benign	0.10
R7012:Muc16	UTSW	9	18495618	critical splice acceptor site	probably null
R7014:Muc16	UTSW	9	18658236	missense	unknown
R7021:Muc16	UTSW	9	18554919	missense	unknown
R7021:Muc16	UTSW	9	18550831	splice site	probably null
R7038:Muc16	UTSW	9	18620468	missense	probably damaging	0.99
R7057:Muc16	UTSW	9	18646079	missense	unknown
R7058:Muc16	UTSW	9	18639755	missense	probably benign	0.10
R7066:Muc16	UTSW	9	18658021	missense	unknown
R7067:Muc16	UTSW	9	18658251	missense	unknown
R7070:Muc16	UTSW	9	18645923	nonsense	probably null
R7074:Muc16	UTSW	9	18655650	missense	unknown
R7085:Muc16	UTSW	9	18644849	missense	unknown
R7088:Muc16	UTSW	9	18592680	missense	probably damaging	0.99
R7107:Muc16	UTSW	9	18637298	missense	probably benign	0.10
R7108:Muc16	UTSW	9	18655233	missense	unknown
R7126:Muc16	UTSW	9	18641216	missense	probably benign	0.01
R7128:Muc16	UTSW	9	18643004	missense	unknown
R7145:Muc16	UTSW	9	18655580	missense	unknown
R7179:Muc16	UTSW	9	18642008	missense	probably benign	0.00
R7194:Muc16	UTSW	9	18674454	missense	unknown
R7211:Muc16	UTSW	9	18498570	missense	probably damaging	1.00
R7213:Muc16	UTSW	9	18641416	missense	probably benign	0.01
R7217:Muc16	UTSW	9	18644076	nonsense	probably null
R7221:Muc16	UTSW	9	18642199	missense	probably benign	0.04
R7265:Muc16	UTSW	9	18656472	missense	unknown
R7326:Muc16	UTSW	9	18585013	missense	probably benign	0.03
R7359:Muc16	UTSW	9	18643020	missense	unknown
R7387:Muc16	UTSW	9	18641720	missense	probably benign	0.01
R7391:Muc16	UTSW	9	18639536	missense	probably benign	0.04
R7398:Muc16	UTSW	9	18637742	missense	possibly damaging	0.46
R7419:Muc16	UTSW	9	18641962	missense	probably benign	0.01
R7431:Muc16	UTSW	9	18607993	missense
R7484:Muc16	UTSW	9	18646768	missense	unknown
R7487:Muc16	UTSW	9	18584799	missense	possibly damaging	0.93
R7497:Muc16	UTSW	9	18645089	missense	unknown
R7515:Muc16	UTSW	9	18639662	missense	probably benign	0.00
R7537:Muc16	UTSW	9	18638135	missense	probably benign	0.06
R7538:Muc16	UTSW	9	18642131	missense	probably benign	0.10
R7538:Muc16	UTSW	9	18655451	missense	unknown
R7543:Muc16	UTSW	9	18644732	missense	unknown
R7566:Muc16	UTSW	9	18638629	missense	probably benign	0.00
R7581:Muc16	UTSW	9	18645614	missense	unknown
R7594:Muc16	UTSW	9	18645062	missense	unknown
R7629:Muc16	UTSW	9	18566785	missense	possibly damaging	0.86
R7664:Muc16	UTSW	9	18607722	missense	probably benign	0.08
R7666:Muc16	UTSW	9	18558427	missense	probably damaging	1.00
R7703:Muc16	UTSW	9	18605282	missense
R7727:Muc16	UTSW	9	18660242	missense	unknown
R7743:Muc16	UTSW	9	18657477	missense	unknown
R7761:Muc16	UTSW	9	18580574	missense	probably damaging	1.00
R7769:Muc16	UTSW	9	18660507	missense	unknown
R7805:Muc16	UTSW	9	18638493	missense	possibly damaging	0.94
R7827:Muc16	UTSW	9	18595223	missense	possibly damaging	0.83
R7845:Muc16	UTSW	9	18640773	missense	probably benign	0.01
R7849:Muc16	UTSW	9	18640505	missense	probably benign	0.01
R7884:Muc16	UTSW	9	18642694	missense	unknown
R7885:Muc16	UTSW	9	18639464	missense	probably benign	0.10
R7886:Muc16	UTSW	9	18585982	missense	probably benign	0.03
R7899:Muc16	UTSW	9	18640697	missense	probably benign	0.01
R7904:Muc16	UTSW	9	18655650	missense	unknown
R7928:Muc16	UTSW	9	18640773	missense	probably benign	0.01
R7932:Muc16	UTSW	9	18640505	missense	probably benign	0.01
R7948:Muc16	UTSW	9	18642490	missense	unknown
R7967:Muc16	UTSW	9	18642694	missense	unknown
R7968:Muc16	UTSW	9	18639464	missense	probably benign	0.10
R7969:Muc16	UTSW	9	18585982	missense	probably benign	0.03
R7982:Muc16	UTSW	9	18640697	missense	probably benign	0.01
R7987:Muc16	UTSW	9	18655650	missense	unknown
R7998:Muc16	UTSW	9	18639892	missense	probably benign	0.04
R8014:Muc16	UTSW	9	18654875	missense	unknown
R8033:Muc16	UTSW	9	18636606	missense	probably benign	0.26
R8052:Muc16	UTSW	9	18659051	missense	unknown
R8058:Muc16	UTSW	9	18660002	nonsense	probably null
Z1177:Muc16	UTSW	9	18537571	missense	probably benign	0.26
Z1177:Muc16	UTSW	9	18657861	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- AGCTCACCGTTGATATAGAGAC -3'
(R):5'- GTCCTCATAGCCTGCAACAG -3'

Sequencing Primer
(F):5'- ATAGAGACTGTTTTCGTCCACG -3'
(R):5'- TTTCTCTGACTTTGAAAGAAAGGAG -3'

Posted On

2019-11-26