Incidental Mutation 'R7744:Slc17a4'
ID596753
Institutional Source Beutler Lab
Gene Symbol Slc17a4
Ensembl Gene ENSMUSG00000021336
Gene Namesolute carrier family 17 (sodium phosphate), member 4
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R7744 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location23895890-23915009 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 23901784 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Leucine at position 382 (W382L)
Ref Sequence ENSEMBL: ENSMUSP00000106037 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021769] [ENSMUST00000110407] [ENSMUST00000225797]
Predicted Effect probably benign
Transcript: ENSMUST00000021769
AA Change: W382L

PolyPhen 2 Score 0.147 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000021769
Gene: ENSMUSG00000021336
AA Change: W382L

DomainStartEndE-ValueType
Pfam:MFS_1 40 373 1.4e-48 PFAM
Pfam:MFS_1 361 492 2.4e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110407
AA Change: W382L

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000106037
Gene: ENSMUSG00000021336
AA Change: W382L

DomainStartEndE-ValueType
Pfam:MFS_1 40 371 1.7e-47 PFAM
Pfam:MFS_1 359 490 3.9e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000225797
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphate homeostasis is maintained by regulating intake, intestinal absorption, bone deposition and resorption, and renal excretion of phosphate. The central molecule in the control of phosphate excretion from the kidney is the sodium/phosphate cotransporter NPT1 (SLC17A1; MIM 182308), which is located in the renal proximal tubule. NPT1 uses the transmembrane electrochemical potential gradient of sodium to transport phosphate across the cell membrane. SLC17A4 is a similar sodium/phosphate cotransporter in the intestinal mucosa that plays an important role in the absorption of phosphate from the intestine (summary by Shibui et al., 1999 [PubMed 10319585]).[supplied by OMIM, Feb 2011]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,290,421 N761K possibly damaging Het
Abi2 A G 1: 60,437,203 I145V probably benign Het
Ampd2 C A 3: 108,080,116 V134L probably benign Het
Atf7ip2 T A 16: 10,241,658 V354E possibly damaging Het
Bglap T C 3: 88,383,651 Y91C probably damaging Het
Cacna1e A T 1: 154,465,792 S1219T probably damaging Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Cd177 A G 7: 24,750,375 C562R probably damaging Het
Cfap57 C T 4: 118,614,931 V84I probably benign Het
Chd7 T A 4: 8,862,485 probably null Het
Dyrk3 A G 1: 131,129,806 V210A probably damaging Het
Eif3c C A 7: 126,558,894 G297W probably damaging Het
Eml1 A G 12: 108,516,604 H494R probably benign Het
Enpp2 A T 15: 54,901,233 probably null Het
Fbxw21 C A 9: 109,157,652 C53F possibly damaging Het
Fndc3a C A 14: 72,561,716 G609V possibly damaging Het
Grid1 A G 14: 35,450,079 D514G probably damaging Het
Gxylt2 T C 6: 100,783,317 V271A probably damaging Het
Hes1 A G 16: 30,066,179 K74R probably damaging Het
Igsf9 A G 1: 172,492,185 N349S probably benign Het
Isx T A 8: 74,873,657 I6N possibly damaging Het
Kcnb1 A T 2: 167,188,331 F98Y probably damaging Het
Kif1b G C 4: 149,237,075 T1129R possibly damaging Het
Klra10 T A 6: 130,272,761 probably null Het
Mcm10 A T 2: 4,991,442 L870Q probably damaging Het
Mettl16 T A 11: 74,803,003 I280K probably benign Het
Mre11a G A 9: 14,809,832 R349Q possibly damaging Het
Mrpl10 C T 11: 97,044,576 T34I probably damaging Het
Muc16 T A 9: 18,585,096 probably null Het
Myt1l T C 12: 29,827,549 C400R unknown Het
Nbr1 C T 11: 101,569,384 T402M probably damaging Het
Ndufs1 A G 1: 63,160,940 M271T possibly damaging Het
Olfr1209 C T 2: 88,909,659 V245I possibly damaging Het
Olfr1494 A G 19: 13,750,055 *316W probably null Het
Olfr562-ps1 G T 7: 102,782,390 V305L probably benign Het
Palm2 T C 4: 57,709,519 S155P probably damaging Het
Pced1a C T 2: 130,422,052 D227N probably damaging Het
Phf21b A G 15: 84,804,869 I152T probably damaging Het
Pla2g4a A G 1: 149,861,102 V430A probably benign Het
Plbd1 T C 6: 136,617,246 E335G probably benign Het
Plce1 G A 19: 38,620,455 V403M possibly damaging Het
Pnpla6 T A 8: 3,531,677 N642K probably benign Het
Ptprb T C 10: 116,277,484 I123T probably benign Het
Rab3il1 T A 19: 10,028,277 probably null Het
Ranbp3 C T 17: 56,708,219 T307M possibly damaging Het
Rasgrp2 T C 19: 6,405,001 S254P probably damaging Het
Rgl3 T C 9: 21,987,570 K191R probably benign Het
Rnf223 G A 4: 156,132,525 R119H probably benign Het
Sapcd2 C T 2: 25,373,496 P217S unknown Het
Setd7 C T 3: 51,526,840 probably null Het
Sh3bp1 A C 15: 78,910,009 T526P possibly damaging Het
Slc26a3 A T 12: 31,463,465 probably null Het
Tmem129 A G 5: 33,654,388 L356P probably damaging Het
Trib1 T A 15: 59,654,663 Y361N probably benign Het
Xirp1 T A 9: 120,016,846 R990S possibly damaging Het
Zfp950 A C 19: 61,127,572 probably null Het
Other mutations in Slc17a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01724:Slc17a4 APN 13 23905533 missense probably benign 0.06
IGL02976:Slc17a4 APN 13 23905424 missense probably damaging 0.99
PIT4581001:Slc17a4 UTSW 13 23902018 missense probably damaging 0.99
PIT4696001:Slc17a4 UTSW 13 23900514 missense probably benign 0.02
R1490:Slc17a4 UTSW 13 23904753 missense probably benign 0.29
R1726:Slc17a4 UTSW 13 23905591 nonsense probably null
R1866:Slc17a4 UTSW 13 23900545 missense possibly damaging 0.67
R3820:Slc17a4 UTSW 13 23901769 missense probably benign
R3821:Slc17a4 UTSW 13 23901769 missense probably benign
R3837:Slc17a4 UTSW 13 23901769 missense probably benign
R3838:Slc17a4 UTSW 13 23901769 missense probably benign
R3839:Slc17a4 UTSW 13 23901769 missense probably benign
R5347:Slc17a4 UTSW 13 23908817 missense possibly damaging 0.63
R5489:Slc17a4 UTSW 13 23898842 splice site probably null
R6607:Slc17a4 UTSW 13 23905414 splice site probably null
R7614:Slc17a4 UTSW 13 23906597 missense probably benign 0.02
R7730:Slc17a4 UTSW 13 23900520 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTGCATCAGAACAAGGGTAGC -3'
(R):5'- TGGCTGTGTCTGCATCATCC -3'

Sequencing Primer
(F):5'- CTAGTGCTCCTGGACCTGAAC -3'
(R):5'- ATCATCCTTGGGGGCCTACTG -3'
Posted On2019-11-26