Incidental Mutation 'R7744:Grid1'
ID596754
Institutional Source Beutler Lab
Gene Symbol Grid1
Ensembl Gene ENSMUSG00000041078
Gene Nameglutamate receptor, ionotropic, delta 1
SynonymsGluRdelta1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R7744 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location34820108-35583379 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 35450079 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 514 (D514G)
Ref Sequence ENSEMBL: ENSMUSP00000044009 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043349]
Predicted Effect probably damaging
Transcript: ENSMUST00000043349
AA Change: D514G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000044009
Gene: ENSMUSG00000041078
AA Change: D514G

DomainStartEndE-ValueType
Pfam:ANF_receptor 36 400 4.1e-51 PFAM
PBPe 438 807 4.68e-110 SMART
Lig_chan-Glu_bd 448 510 8.18e-25 SMART
low complexity region 838 853 N/A INTRINSIC
low complexity region 943 958 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of glutamate receptor channels. These channels mediate most of the fast excitatory synaptic transmission in the central nervous system and play key roles in synaptic plasticity.[provided by RefSeq, Jan 2009]
PHENOTYPE: Homozygotes for a targeted null mutation display a significant high-frequency hearing loss, associated with reductions of both cochlear outer hair cell function and endolymphatic potential, as well as increased vulnerability to acoustic injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,290,421 N761K possibly damaging Het
Abi2 A G 1: 60,437,203 I145V probably benign Het
Ampd2 C A 3: 108,080,116 V134L probably benign Het
Atf7ip2 T A 16: 10,241,658 V354E possibly damaging Het
Bglap T C 3: 88,383,651 Y91C probably damaging Het
Cacna1e A T 1: 154,465,792 S1219T probably damaging Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Cd177 A G 7: 24,750,375 C562R probably damaging Het
Cfap57 C T 4: 118,614,931 V84I probably benign Het
Chd7 T A 4: 8,862,485 probably null Het
Dyrk3 A G 1: 131,129,806 V210A probably damaging Het
Eif3c C A 7: 126,558,894 G297W probably damaging Het
Eml1 A G 12: 108,516,604 H494R probably benign Het
Enpp2 A T 15: 54,901,233 probably null Het
Fbxw21 C A 9: 109,157,652 C53F possibly damaging Het
Fndc3a C A 14: 72,561,716 G609V possibly damaging Het
Gxylt2 T C 6: 100,783,317 V271A probably damaging Het
Hes1 A G 16: 30,066,179 K74R probably damaging Het
Igsf9 A G 1: 172,492,185 N349S probably benign Het
Isx T A 8: 74,873,657 I6N possibly damaging Het
Kcnb1 A T 2: 167,188,331 F98Y probably damaging Het
Kif1b G C 4: 149,237,075 T1129R possibly damaging Het
Klra10 T A 6: 130,272,761 probably null Het
Mcm10 A T 2: 4,991,442 L870Q probably damaging Het
Mettl16 T A 11: 74,803,003 I280K probably benign Het
Mre11a G A 9: 14,809,832 R349Q possibly damaging Het
Mrpl10 C T 11: 97,044,576 T34I probably damaging Het
Muc16 T A 9: 18,585,096 probably null Het
Myt1l T C 12: 29,827,549 C400R unknown Het
Nbr1 C T 11: 101,569,384 T402M probably damaging Het
Ndufs1 A G 1: 63,160,940 M271T possibly damaging Het
Olfr1209 C T 2: 88,909,659 V245I possibly damaging Het
Olfr1494 A G 19: 13,750,055 *316W probably null Het
Olfr562-ps1 G T 7: 102,782,390 V305L probably benign Het
Palm2 T C 4: 57,709,519 S155P probably damaging Het
Pced1a C T 2: 130,422,052 D227N probably damaging Het
Phf21b A G 15: 84,804,869 I152T probably damaging Het
Pla2g4a A G 1: 149,861,102 V430A probably benign Het
Plbd1 T C 6: 136,617,246 E335G probably benign Het
Plce1 G A 19: 38,620,455 V403M possibly damaging Het
Pnpla6 T A 8: 3,531,677 N642K probably benign Het
Ptprb T C 10: 116,277,484 I123T probably benign Het
Rab3il1 T A 19: 10,028,277 probably null Het
Ranbp3 C T 17: 56,708,219 T307M possibly damaging Het
Rasgrp2 T C 19: 6,405,001 S254P probably damaging Het
Rgl3 T C 9: 21,987,570 K191R probably benign Het
Rnf223 G A 4: 156,132,525 R119H probably benign Het
Sapcd2 C T 2: 25,373,496 P217S unknown Het
Setd7 C T 3: 51,526,840 probably null Het
Sh3bp1 A C 15: 78,910,009 T526P possibly damaging Het
Slc17a4 C A 13: 23,901,784 W382L probably benign Het
Slc26a3 A T 12: 31,463,465 probably null Het
Tmem129 A G 5: 33,654,388 L356P probably damaging Het
Trib1 T A 15: 59,654,663 Y361N probably benign Het
Xirp1 T A 9: 120,016,846 R990S possibly damaging Het
Zfp950 A C 19: 61,127,572 probably null Het
Other mutations in Grid1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00705:Grid1 APN 14 35445887 missense possibly damaging 0.70
IGL01016:Grid1 APN 14 34822639 nonsense probably null
IGL01643:Grid1 APN 14 35323435 critical splice donor site probably null
IGL01697:Grid1 APN 14 35309257 missense probably benign 0.21
IGL01879:Grid1 APN 14 35450370 missense possibly damaging 0.93
IGL01975:Grid1 APN 14 35323426 missense probably benign
IGL02515:Grid1 APN 14 35452345 missense probably damaging 0.99
IGL02935:Grid1 APN 14 34822558 missense possibly damaging 0.86
IGL03279:Grid1 APN 14 34945765 missense probably damaging 0.98
IGL03286:Grid1 APN 14 35520685 splice site probably benign
IGL03296:Grid1 APN 14 35580567 missense possibly damaging 0.52
IGL03305:Grid1 APN 14 35251707 missense probably damaging 1.00
R0533:Grid1 UTSW 14 35309385 missense possibly damaging 0.84
R0746:Grid1 UTSW 14 34822690 missense possibly damaging 0.92
R0811:Grid1 UTSW 14 34822619 missense probably benign
R0812:Grid1 UTSW 14 34822619 missense probably benign
R1144:Grid1 UTSW 14 35562676 splice site probably benign
R1217:Grid1 UTSW 14 34820229 start codon destroyed probably null 0.53
R1485:Grid1 UTSW 14 34822583 missense probably damaging 1.00
R1529:Grid1 UTSW 14 35309293 missense probably benign 0.36
R1606:Grid1 UTSW 14 35445965 missense probably damaging 0.96
R1691:Grid1 UTSW 14 35452329 missense probably damaging 1.00
R1759:Grid1 UTSW 14 35446031 missense possibly damaging 0.92
R2374:Grid1 UTSW 14 35321807 splice site probably benign
R2415:Grid1 UTSW 14 35450369 missense possibly damaging 0.69
R2866:Grid1 UTSW 14 35562559 missense probably damaging 1.00
R3915:Grid1 UTSW 14 35520727 missense probably damaging 1.00
R4044:Grid1 UTSW 14 35450401 splice site probably benign
R4364:Grid1 UTSW 14 34946032 missense probably benign 0.20
R4691:Grid1 UTSW 14 35569557 missense probably benign
R4694:Grid1 UTSW 14 35026780 missense probably damaging 1.00
R4749:Grid1 UTSW 14 35580687 missense possibly damaging 0.50
R4794:Grid1 UTSW 14 34822622 missense probably damaging 0.99
R4854:Grid1 UTSW 14 35321641 missense probably benign
R5555:Grid1 UTSW 14 35520705 missense possibly damaging 0.92
R6005:Grid1 UTSW 14 35323412 missense probably damaging 1.00
R6176:Grid1 UTSW 14 35562547 missense probably benign 0.00
R6569:Grid1 UTSW 14 35323339 missense possibly damaging 0.72
R6911:Grid1 UTSW 14 34820228 start codon destroyed probably benign 0.08
R7504:Grid1 UTSW 14 35562513 missense probably damaging 1.00
R7795:Grid1 UTSW 14 35321685 missense probably damaging 1.00
R7883:Grid1 UTSW 14 35450302 splice site probably null
R7913:Grid1 UTSW 14 35569697 missense probably damaging 0.99
R8032:Grid1 UTSW 14 35323359 missense probably benign 0.00
R8333:Grid1 UTSW 14 35569638 missense possibly damaging 0.82
U24488:Grid1 UTSW 14 35580577 missense probably benign 0.00
Z1088:Grid1 UTSW 14 35452294 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTAGGTCCAGGGAGAGACATC -3'
(R):5'- TTCAACACGAATATGAGCACG -3'

Sequencing Primer
(F):5'- GTCCAGGGAGAGACATCTATAAG -3'
(R):5'- ACCACAGGAATGGCTGC -3'
Posted On2019-11-26