Incidental Mutation 'R7744:Ranbp3'
ID 596761
Institutional Source Beutler Lab
Gene Symbol Ranbp3
Ensembl Gene ENSMUSG00000002372
Gene Name RAN binding protein 3
Synonyms 2610024N24Rik
MMRRC Submission 045800-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.958) question?
Stock # R7744 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 56980294-57018764 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 57015219 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Methionine at position 307 (T307M)
Ref Sequence ENSEMBL: ENSMUSP00000002445 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002445]
AlphaFold Q9CT10
Predicted Effect possibly damaging
Transcript: ENSMUST00000002445
AA Change: T307M

PolyPhen 2 Score 0.920 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000002445
Gene: ENSMUSG00000002372
AA Change: T307M

DomainStartEndE-ValueType
low complexity region 275 287 N/A INTRINSIC
RanBD 305 432 1.7e-12 SMART
low complexity region 439 454 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with a RanBD1 domain that is found in both the nucleus and cytoplasm. This protein plays a role in nuclear export as part of a heteromeric complex. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,240,421 (GRCm39) N761K possibly damaging Het
Abi2 A G 1: 60,476,362 (GRCm39) I145V probably benign Het
Ampd2 C A 3: 107,987,432 (GRCm39) V134L probably benign Het
Atf7ip2 T A 16: 10,059,522 (GRCm39) V354E possibly damaging Het
Bglap T C 3: 88,290,958 (GRCm39) Y91C probably damaging Het
Cacna1e A T 1: 154,341,538 (GRCm39) S1219T probably damaging Het
Ccng2 C G 5: 93,421,202 (GRCm39) S237R probably benign Het
Cd177 A G 7: 24,449,800 (GRCm39) C562R probably damaging Het
Cfap57 C T 4: 118,472,128 (GRCm39) V84I probably benign Het
Chd7 T A 4: 8,862,485 (GRCm39) probably null Het
Dyrk3 A G 1: 131,057,543 (GRCm39) V210A probably damaging Het
Eif3c C A 7: 126,158,066 (GRCm39) G297W probably damaging Het
Eml1 A G 12: 108,482,863 (GRCm39) H494R probably benign Het
Enpp2 A T 15: 54,764,629 (GRCm39) probably null Het
Fbxw21 C A 9: 108,986,720 (GRCm39) C53F possibly damaging Het
Fndc3a C A 14: 72,799,156 (GRCm39) G609V possibly damaging Het
Grid1 A G 14: 35,172,036 (GRCm39) D514G probably damaging Het
Gxylt2 T C 6: 100,760,278 (GRCm39) V271A probably damaging Het
Hes1 A G 16: 29,884,997 (GRCm39) K74R probably damaging Het
Igsf9 A G 1: 172,319,752 (GRCm39) N349S probably benign Het
Isx T A 8: 75,600,285 (GRCm39) I6N possibly damaging Het
Kcnb1 A T 2: 167,030,251 (GRCm39) F98Y probably damaging Het
Kif1b G C 4: 149,321,532 (GRCm39) T1129R possibly damaging Het
Klra10 T A 6: 130,249,724 (GRCm39) probably null Het
Mcm10 A T 2: 4,996,253 (GRCm39) L870Q probably damaging Het
Mettl16 T A 11: 74,693,829 (GRCm39) I280K probably benign Het
Mre11a G A 9: 14,721,128 (GRCm39) R349Q possibly damaging Het
Mrpl10 C T 11: 96,935,402 (GRCm39) T34I probably damaging Het
Muc16 T A 9: 18,496,392 (GRCm39) probably null Het
Myt1l T C 12: 29,877,548 (GRCm39) C400R unknown Het
Nbr1 C T 11: 101,460,210 (GRCm39) T402M probably damaging Het
Ndufs1 A G 1: 63,200,099 (GRCm39) M271T possibly damaging Het
Or10q1 A G 19: 13,727,419 (GRCm39) *316W probably null Het
Or4c29 C T 2: 88,740,003 (GRCm39) V245I possibly damaging Het
Or51f23c-ps1 G T 7: 102,431,597 (GRCm39) V305L probably benign Het
Pakap T C 4: 57,709,519 (GRCm39) S155P probably damaging Het
Pced1a C T 2: 130,263,972 (GRCm39) D227N probably damaging Het
Phf21b A G 15: 84,689,070 (GRCm39) I152T probably damaging Het
Pla2g4a A G 1: 149,736,853 (GRCm39) V430A probably benign Het
Plbd1 T C 6: 136,594,244 (GRCm39) E335G probably benign Het
Plce1 G A 19: 38,608,899 (GRCm39) V403M possibly damaging Het
Pnpla6 T A 8: 3,581,677 (GRCm39) N642K probably benign Het
Ptprb T C 10: 116,113,389 (GRCm39) I123T probably benign Het
Rab3il1 T A 19: 10,005,641 (GRCm39) probably null Het
Rasgrp2 T C 19: 6,455,031 (GRCm39) S254P probably damaging Het
Rgl3 T C 9: 21,898,866 (GRCm39) K191R probably benign Het
Rnf223 G A 4: 156,216,982 (GRCm39) R119H probably benign Het
Sapcd2 C T 2: 25,263,508 (GRCm39) P217S unknown Het
Setd7 C T 3: 51,434,261 (GRCm39) probably null Het
Sh3bp1 A C 15: 78,794,209 (GRCm39) T526P possibly damaging Het
Slc17a4 C A 13: 24,085,767 (GRCm39) W382L probably benign Het
Slc26a3 A T 12: 31,513,464 (GRCm39) probably null Het
Tmem129 A G 5: 33,811,732 (GRCm39) L356P probably damaging Het
Trib1 T A 15: 59,526,512 (GRCm39) Y361N probably benign Het
Xirp1 T A 9: 119,845,912 (GRCm39) R990S possibly damaging Het
Zfp950 A C 19: 61,116,010 (GRCm39) probably null Het
Other mutations in Ranbp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Ranbp3 APN 17 57,016,238 (GRCm39) missense probably damaging 1.00
IGL02801:Ranbp3 APN 17 57,017,766 (GRCm39) missense probably benign
IGL03004:Ranbp3 APN 17 57,014,207 (GRCm39) missense probably damaging 1.00
Waif UTSW 17 56,984,208 (GRCm39) splice site probably null
R0094:Ranbp3 UTSW 17 57,016,338 (GRCm39) unclassified probably benign
R0139:Ranbp3 UTSW 17 57,016,272 (GRCm39) missense possibly damaging 0.95
R0419:Ranbp3 UTSW 17 57,015,219 (GRCm39) missense possibly damaging 0.92
R0426:Ranbp3 UTSW 17 57,014,169 (GRCm39) missense probably benign
R0629:Ranbp3 UTSW 17 57,015,200 (GRCm39) missense possibly damaging 0.95
R0632:Ranbp3 UTSW 17 57,009,896 (GRCm39) splice site probably benign
R1495:Ranbp3 UTSW 17 57,012,527 (GRCm39) missense probably benign 0.03
R1525:Ranbp3 UTSW 17 57,017,865 (GRCm39) missense possibly damaging 0.52
R2044:Ranbp3 UTSW 17 56,980,367 (GRCm39) start gained probably benign
R2093:Ranbp3 UTSW 17 57,017,145 (GRCm39) missense probably damaging 1.00
R4649:Ranbp3 UTSW 17 57,003,640 (GRCm39) critical splice donor site probably null
R4780:Ranbp3 UTSW 17 56,980,346 (GRCm39) start gained probably benign
R5568:Ranbp3 UTSW 17 57,008,543 (GRCm39) critical splice donor site probably null
R5642:Ranbp3 UTSW 17 57,017,703 (GRCm39) missense probably benign 0.01
R5806:Ranbp3 UTSW 17 57,017,717 (GRCm39) missense probably benign 0.01
R5875:Ranbp3 UTSW 17 57,014,955 (GRCm39) critical splice donor site probably null
R6142:Ranbp3 UTSW 17 56,993,018 (GRCm39) missense probably benign 0.33
R6250:Ranbp3 UTSW 17 56,984,208 (GRCm39) splice site probably null
R6745:Ranbp3 UTSW 17 57,016,308 (GRCm39) missense probably benign 0.24
R7222:Ranbp3 UTSW 17 57,017,211 (GRCm39) missense probably damaging 1.00
R7571:Ranbp3 UTSW 17 57,014,923 (GRCm39) missense probably benign 0.01
R7718:Ranbp3 UTSW 17 57,003,718 (GRCm39) missense probably damaging 0.99
R8504:Ranbp3 UTSW 17 57,015,273 (GRCm39) missense probably damaging 0.98
R8746:Ranbp3 UTSW 17 57,009,826 (GRCm39) missense probably benign
R9133:Ranbp3 UTSW 17 57,003,791 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GGCCTGAATTGCCCATTATG -3'
(R):5'- ATTCAGGAGTAAGTTGTCACAGTG -3'

Sequencing Primer
(F):5'- CCATTATGGGCACTGGGTG -3'
(R):5'- CTGGCCTCAAGTTCAGAGAGATCTG -3'
Posted On 2019-11-26