Incidental Mutation 'R7744:Ranbp3'
ID 596761
Institutional Source Beutler Lab
Gene Symbol Ranbp3
Ensembl Gene ENSMUSG00000002372
Gene Name RAN binding protein 3
Synonyms 2610024N24Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.955) question?
Stock # R7744 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 56673225-56711769 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 56708219 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Methionine at position 307 (T307M)
Ref Sequence ENSEMBL: ENSMUSP00000002445 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002445]
AlphaFold Q9CT10
Predicted Effect possibly damaging
Transcript: ENSMUST00000002445
AA Change: T307M

PolyPhen 2 Score 0.920 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000002445
Gene: ENSMUSG00000002372
AA Change: T307M

DomainStartEndE-ValueType
low complexity region 275 287 N/A INTRINSIC
RanBD 305 432 1.7e-12 SMART
low complexity region 439 454 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with a RanBD1 domain that is found in both the nucleus and cytoplasm. This protein plays a role in nuclear export as part of a heteromeric complex. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,290,421 N761K possibly damaging Het
Abi2 A G 1: 60,437,203 I145V probably benign Het
Ampd2 C A 3: 108,080,116 V134L probably benign Het
Atf7ip2 T A 16: 10,241,658 V354E possibly damaging Het
Bglap T C 3: 88,383,651 Y91C probably damaging Het
Cacna1e A T 1: 154,465,792 S1219T probably damaging Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Cd177 A G 7: 24,750,375 C562R probably damaging Het
Cfap57 C T 4: 118,614,931 V84I probably benign Het
Chd7 T A 4: 8,862,485 probably null Het
Dyrk3 A G 1: 131,129,806 V210A probably damaging Het
Eif3c C A 7: 126,558,894 G297W probably damaging Het
Eml1 A G 12: 108,516,604 H494R probably benign Het
Enpp2 A T 15: 54,901,233 probably null Het
Fbxw21 C A 9: 109,157,652 C53F possibly damaging Het
Fndc3a C A 14: 72,561,716 G609V possibly damaging Het
Grid1 A G 14: 35,450,079 D514G probably damaging Het
Gxylt2 T C 6: 100,783,317 V271A probably damaging Het
Hes1 A G 16: 30,066,179 K74R probably damaging Het
Igsf9 A G 1: 172,492,185 N349S probably benign Het
Isx T A 8: 74,873,657 I6N possibly damaging Het
Kcnb1 A T 2: 167,188,331 F98Y probably damaging Het
Kif1b G C 4: 149,237,075 T1129R possibly damaging Het
Klra10 T A 6: 130,272,761 probably null Het
Mcm10 A T 2: 4,991,442 L870Q probably damaging Het
Mettl16 T A 11: 74,803,003 I280K probably benign Het
Mre11a G A 9: 14,809,832 R349Q possibly damaging Het
Mrpl10 C T 11: 97,044,576 T34I probably damaging Het
Muc16 T A 9: 18,585,096 probably null Het
Myt1l T C 12: 29,827,549 C400R unknown Het
Nbr1 C T 11: 101,569,384 T402M probably damaging Het
Ndufs1 A G 1: 63,160,940 M271T possibly damaging Het
Olfr1209 C T 2: 88,909,659 V245I possibly damaging Het
Olfr1494 A G 19: 13,750,055 *316W probably null Het
Olfr562-ps1 G T 7: 102,782,390 V305L probably benign Het
Palm2 T C 4: 57,709,519 S155P probably damaging Het
Pced1a C T 2: 130,422,052 D227N probably damaging Het
Phf21b A G 15: 84,804,869 I152T probably damaging Het
Pla2g4a A G 1: 149,861,102 V430A probably benign Het
Plbd1 T C 6: 136,617,246 E335G probably benign Het
Plce1 G A 19: 38,620,455 V403M possibly damaging Het
Pnpla6 T A 8: 3,531,677 N642K probably benign Het
Ptprb T C 10: 116,277,484 I123T probably benign Het
Rab3il1 T A 19: 10,028,277 probably null Het
Rasgrp2 T C 19: 6,405,001 S254P probably damaging Het
Rgl3 T C 9: 21,987,570 K191R probably benign Het
Rnf223 G A 4: 156,132,525 R119H probably benign Het
Sapcd2 C T 2: 25,373,496 P217S unknown Het
Setd7 C T 3: 51,526,840 probably null Het
Sh3bp1 A C 15: 78,910,009 T526P possibly damaging Het
Slc17a4 C A 13: 23,901,784 W382L probably benign Het
Slc26a3 A T 12: 31,463,465 probably null Het
Tmem129 A G 5: 33,654,388 L356P probably damaging Het
Trib1 T A 15: 59,654,663 Y361N probably benign Het
Xirp1 T A 9: 120,016,846 R990S possibly damaging Het
Zfp950 A C 19: 61,127,572 probably null Het
Other mutations in Ranbp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Ranbp3 APN 17 56709238 missense probably damaging 1.00
IGL02801:Ranbp3 APN 17 56710766 missense probably benign
IGL03004:Ranbp3 APN 17 56707207 missense probably damaging 1.00
Waif UTSW 17 56677208 splice site probably null
R0094:Ranbp3 UTSW 17 56709338 unclassified probably benign
R0139:Ranbp3 UTSW 17 56709272 missense possibly damaging 0.95
R0419:Ranbp3 UTSW 17 56708219 missense possibly damaging 0.92
R0426:Ranbp3 UTSW 17 56707169 missense probably benign
R0629:Ranbp3 UTSW 17 56708200 missense possibly damaging 0.95
R0632:Ranbp3 UTSW 17 56702896 splice site probably benign
R1495:Ranbp3 UTSW 17 56705527 missense probably benign 0.03
R1525:Ranbp3 UTSW 17 56710865 missense possibly damaging 0.52
R2044:Ranbp3 UTSW 17 56673367 start gained probably benign
R2093:Ranbp3 UTSW 17 56710145 missense probably damaging 1.00
R4649:Ranbp3 UTSW 17 56696640 critical splice donor site probably null
R4780:Ranbp3 UTSW 17 56673346 start gained probably benign
R5568:Ranbp3 UTSW 17 56701543 critical splice donor site probably null
R5642:Ranbp3 UTSW 17 56710703 missense probably benign 0.01
R5806:Ranbp3 UTSW 17 56710717 missense probably benign 0.01
R5875:Ranbp3 UTSW 17 56707955 critical splice donor site probably null
R6142:Ranbp3 UTSW 17 56686018 missense probably benign 0.33
R6250:Ranbp3 UTSW 17 56677208 splice site probably null
R6745:Ranbp3 UTSW 17 56709308 missense probably benign 0.24
R7222:Ranbp3 UTSW 17 56710211 missense probably damaging 1.00
R7571:Ranbp3 UTSW 17 56707923 missense probably benign 0.01
R7718:Ranbp3 UTSW 17 56696718 missense probably damaging 0.99
R8504:Ranbp3 UTSW 17 56708273 missense probably damaging 0.98
R8746:Ranbp3 UTSW 17 56702826 missense probably benign
R9133:Ranbp3 UTSW 17 56696791 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GGCCTGAATTGCCCATTATG -3'
(R):5'- ATTCAGGAGTAAGTTGTCACAGTG -3'

Sequencing Primer
(F):5'- CCATTATGGGCACTGGGTG -3'
(R):5'- CTGGCCTCAAGTTCAGAGAGATCTG -3'
Posted On 2019-11-26