Incidental Mutation 'R7745:Phf3'
ID596765
Institutional Source Beutler Lab
Gene Symbol Phf3
Ensembl Gene ENSMUSG00000048874
Gene NamePHD finger protein 3
SynonymsAU020177, 2310061N19Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7745 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location30802339-30873921 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 30804224 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 1885 (W1885R)
Ref Sequence ENSEMBL: ENSMUSP00000085650 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088310] [ENSMUST00000186733] [ENSMUST00000191329]
Predicted Effect probably damaging
Transcript: ENSMUST00000088310
AA Change: W1885R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000085650
Gene: ENSMUSG00000048874
AA Change: W1885R

DomainStartEndE-ValueType
low complexity region 212 223 N/A INTRINSIC
low complexity region 337 344 N/A INTRINSIC
low complexity region 600 611 N/A INTRINSIC
low complexity region 651 660 N/A INTRINSIC
PHD 697 748 3.82e-10 SMART
low complexity region 847 859 N/A INTRINSIC
low complexity region 876 887 N/A INTRINSIC
TFS2M 908 1008 1.28e-47 SMART
Pfam:SPOC 1188 1294 4.2e-26 PFAM
low complexity region 1367 1373 N/A INTRINSIC
low complexity region 1516 1529 N/A INTRINSIC
low complexity region 1597 1620 N/A INTRINSIC
low complexity region 1796 1811 N/A INTRINSIC
low complexity region 1813 1846 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000186733
AA Change: W1885R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139610
Gene: ENSMUSG00000048874
AA Change: W1885R

DomainStartEndE-ValueType
low complexity region 212 223 N/A INTRINSIC
low complexity region 337 344 N/A INTRINSIC
low complexity region 600 611 N/A INTRINSIC
low complexity region 651 660 N/A INTRINSIC
PHD 697 748 3.82e-10 SMART
low complexity region 847 859 N/A INTRINSIC
low complexity region 876 887 N/A INTRINSIC
TFS2M 908 1008 1.28e-47 SMART
Pfam:SPOC 1188 1294 4.2e-26 PFAM
low complexity region 1367 1373 N/A INTRINSIC
low complexity region 1516 1529 N/A INTRINSIC
low complexity region 1597 1620 N/A INTRINSIC
low complexity region 1796 1811 N/A INTRINSIC
low complexity region 1813 1846 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000191329
SMART Domains Protein: ENSMUSP00000139662
Gene: ENSMUSG00000048874

DomainStartEndE-ValueType
Pfam:SPOC 1 88 1.9e-17 PFAM
Meta Mutation Damage Score 0.1305 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 96% (55/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a PHD finger-containing gene family. This gene may function as a transcription factor and may be involved in glioblastomas development. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadac A C 3: 60,038,472 S188R probably damaging Het
Aars T A 8: 111,041,657 I220N probably damaging Het
Abca15 A G 7: 120,332,217 N16S probably damaging Het
Adck1 A T 12: 88,456,800 M358L probably benign Het
Adck5 A T 15: 76,594,548 Q345L probably benign Het
Adgrl2 A G 3: 148,836,458 F876S probably damaging Het
Aebp2 T A 6: 140,623,858 L55Q unknown Het
Ampd2 C A 3: 108,080,116 V134L probably benign Het
Aox3 T C 1: 58,176,517 V1036A possibly damaging Het
Aox4 A G 1: 58,240,707 D494G probably benign Het
Cacna1a C A 8: 84,559,394 H889Q probably benign Het
Cacna1c T C 6: 119,052,626 D151G Het
Car8 A G 4: 8,237,939 V92A possibly damaging Het
Ccdc8 G T 7: 16,995,689 A368S unknown Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Cfap57 C T 4: 118,614,931 V84I probably benign Het
Cntnap5a A G 1: 116,442,283 I877V probably benign Het
Copa A T 1: 172,111,942 D582V probably damaging Het
Cpne2 T G 8: 94,568,684 S466A probably damaging Het
Crybg2 A G 4: 134,088,845 K1311R possibly damaging Het
Csmd1 A G 8: 15,932,461 probably null Het
Dnah2 A T 11: 69,451,318 C2947* probably null Het
Exoc1 A T 5: 76,561,512 K656* probably null Het
Exoc8 T C 8: 124,895,819 N603S probably benign Het
Fam171a1 T A 2: 3,225,446 C539S possibly damaging Het
Fastkd5 A T 2: 130,615,068 I534K probably damaging Het
Fbn1 T C 2: 125,303,195 D2708G probably benign Het
Fhad1 A G 4: 141,890,939 L1392P probably benign Het
Fras1 A T 5: 96,726,895 T2306S probably benign Het
Gdf7 G T 12: 8,301,854 A27E unknown Het
Hnrnph1 A T 11: 50,379,497 I43F probably damaging Het
Igkv8-27 T A 6: 70,172,015 S52C probably benign Het
Jmjd1c T C 10: 67,217,045 F24L probably damaging Het
Knl1 T G 2: 119,071,556 L1246R probably benign Het
Limk2 C T 11: 3,355,896 S191N probably damaging Het
Mdga2 G A 12: 66,689,350 A368V probably damaging Het
Mdga2 C A 12: 66,689,351 A368S possibly damaging Het
Med24 A T 11: 98,704,967 L966Q probably damaging Het
Mgll T C 6: 88,725,788 V23A possibly damaging Het
Nedd1 C T 10: 92,714,172 D84N probably benign Het
Obscn A C 11: 59,060,855 L4024R probably damaging Het
Olfr172 A T 16: 58,760,419 Y252* probably null Het
Pcnx2 T C 8: 125,851,107 I944V probably benign Het
Pecr T C 1: 72,266,998 probably null Het
Pitpnm2 C G 5: 124,128,705 A697P probably benign Het
Piwil2 T A 14: 70,394,189 H602L probably benign Het
Pprc1 T C 19: 46,065,342 S1104P unknown Het
Prkar1a T A 11: 109,653,847 Y21* probably null Het
Prl2c3 A T 13: 12,798,297 Y9* probably null Het
Rhbdl3 T A 11: 80,323,579 L172Q possibly damaging Het
Rsph3a T G 17: 7,979,243 L484W probably damaging Het
Sbno1 A T 5: 124,392,899 S809T probably benign Het
Stmnd1 T A 13: 46,299,601 V251E possibly damaging Het
Stt3a A T 9: 36,751,239 C241* probably null Het
Tas2r114 A T 6: 131,689,438 M209K probably damaging Het
Tchh G T 3: 93,444,777 R508L unknown Het
Tgfbr3l T C 8: 4,250,622 S267P possibly damaging Het
Ttn T A 2: 76,767,800 I19590F probably damaging Het
Vmn1r171 A G 7: 23,632,610 T87A probably benign Het
Other mutations in Phf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Phf3 APN 1 30811847 missense probably damaging 0.99
IGL00704:Phf3 APN 1 30804838 missense probably benign
IGL01147:Phf3 APN 1 30804169 missense probably damaging 1.00
IGL01360:Phf3 APN 1 30808728 missense probably damaging 1.00
IGL01376:Phf3 APN 1 30830485 missense possibly damaging 0.62
IGL01396:Phf3 APN 1 30804305 nonsense probably null
IGL01830:Phf3 APN 1 30814067 nonsense probably null
IGL02108:Phf3 APN 1 30829951 missense probably damaging 1.00
IGL02156:Phf3 APN 1 30808778 missense probably damaging 1.00
IGL02576:Phf3 APN 1 30830036 missense probably benign 0.01
IGL03031:Phf3 APN 1 30804653 missense probably benign 0.00
IGL03334:Phf3 APN 1 30805729 missense probably damaging 0.99
IGL03411:Phf3 APN 1 30804401 missense probably damaging 1.00
FR4976:Phf3 UTSW 1 30805023 utr 3 prime probably benign
PIT4458001:Phf3 UTSW 1 30816541 missense probably damaging 1.00
R0037:Phf3 UTSW 1 30804918 missense probably benign 0.03
R0052:Phf3 UTSW 1 30808767 missense probably damaging 1.00
R0114:Phf3 UTSW 1 30805443 missense possibly damaging 0.87
R0123:Phf3 UTSW 1 30805065 missense probably benign 0.01
R0225:Phf3 UTSW 1 30805065 missense probably benign 0.01
R0715:Phf3 UTSW 1 30811838 missense probably damaging 1.00
R0835:Phf3 UTSW 1 30830551 missense probably benign 0.02
R0848:Phf3 UTSW 1 30863172 missense probably damaging 1.00
R1473:Phf3 UTSW 1 30805940 missense probably damaging 1.00
R1522:Phf3 UTSW 1 30805648 missense probably benign 0.05
R1549:Phf3 UTSW 1 30804842 missense probably benign 0.00
R1555:Phf3 UTSW 1 30805877 missense possibly damaging 0.86
R1780:Phf3 UTSW 1 30811942 missense probably damaging 1.00
R1789:Phf3 UTSW 1 30806206 missense probably damaging 1.00
R1875:Phf3 UTSW 1 30830623 missense possibly damaging 0.81
R1912:Phf3 UTSW 1 30804345 missense probably damaging 1.00
R1957:Phf3 UTSW 1 30831520 missense probably damaging 1.00
R2019:Phf3 UTSW 1 30811847 missense probably damaging 0.99
R2259:Phf3 UTSW 1 30804343 missense probably benign 0.20
R2305:Phf3 UTSW 1 30805475 nonsense probably null
R2345:Phf3 UTSW 1 30805351 nonsense probably null
R2424:Phf3 UTSW 1 30806349 missense probably damaging 1.00
R2497:Phf3 UTSW 1 30830014 missense probably damaging 1.00
R2504:Phf3 UTSW 1 30810789 missense probably damaging 1.00
R3522:Phf3 UTSW 1 30805603 missense probably damaging 1.00
R3816:Phf3 UTSW 1 30805753 missense probably damaging 1.00
R4152:Phf3 UTSW 1 30831458 missense probably benign 0.13
R4403:Phf3 UTSW 1 30804409 missense probably damaging 1.00
R4658:Phf3 UTSW 1 30863088 missense probably damaging 1.00
R4663:Phf3 UTSW 1 30821215 missense probably damaging 1.00
R4669:Phf3 UTSW 1 30829946 missense probably damaging 1.00
R4706:Phf3 UTSW 1 30805606 missense probably damaging 1.00
R4757:Phf3 UTSW 1 30820827 missense probably damaging 1.00
R4766:Phf3 UTSW 1 30813939 unclassified probably benign
R4786:Phf3 UTSW 1 30816557 nonsense probably null
R5107:Phf3 UTSW 1 30831485 missense probably benign 0.03
R5155:Phf3 UTSW 1 30824376 missense possibly damaging 0.87
R5310:Phf3 UTSW 1 30803806 missense probably damaging 1.00
R5823:Phf3 UTSW 1 30804683 missense probably damaging 1.00
R5944:Phf3 UTSW 1 30820704 missense probably damaging 1.00
R5979:Phf3 UTSW 1 30805746 missense probably damaging 1.00
R6007:Phf3 UTSW 1 30804345 missense probably damaging 1.00
R6024:Phf3 UTSW 1 30863226 missense probably damaging 1.00
R6072:Phf3 UTSW 1 30830688 missense probably benign 0.08
R6533:Phf3 UTSW 1 30806318 missense probably damaging 1.00
R6649:Phf3 UTSW 1 30805023 missense possibly damaging 0.75
R6653:Phf3 UTSW 1 30805023 missense possibly damaging 0.75
R6852:Phf3 UTSW 1 30804630 missense probably damaging 0.97
R6855:Phf3 UTSW 1 30820123 missense probably damaging 1.00
R6862:Phf3 UTSW 1 30813982 missense probably damaging 1.00
R6930:Phf3 UTSW 1 30811877 missense probably damaging 1.00
R7135:Phf3 UTSW 1 30831109 missense possibly damaging 0.61
R7323:Phf3 UTSW 1 30813130 missense probably benign 0.01
R7352:Phf3 UTSW 1 30804326 missense possibly damaging 0.87
R7455:Phf3 UTSW 1 30837158 missense probably damaging 0.96
R7549:Phf3 UTSW 1 30831475 missense probably benign 0.01
R7609:Phf3 UTSW 1 30805501 missense probably benign 0.05
R7720:Phf3 UTSW 1 30829857 missense probably damaging 1.00
R8134:Phf3 UTSW 1 30824471 missense unknown
R8264:Phf3 UTSW 1 30831057 missense possibly damaging 0.48
Z1177:Phf3 UTSW 1 30804295 missense probably damaging 1.00
Z1177:Phf3 UTSW 1 30805051 missense unknown
Z1177:Phf3 UTSW 1 30811968 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GTCCGGTTTCTTGTCTGCAC -3'
(R):5'- GGCTTCGGCTTCCCTCAAA -3'

Sequencing Primer
(F):5'- TTCCCATCTGGTGCCCGG -3'
(R):5'- CGGCTTCCCTCAAAATCCC -3'
Posted On2019-11-26