Incidental Mutation 'R7745:Knl1'
ID596772
Institutional Source Beutler Lab
Gene Symbol Knl1
Ensembl Gene ENSMUSG00000027326
Gene Namekinetochore scaffold 1
Synonyms2310043D08Rik, 5730505K17Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7745 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location119047119-119105501 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 119071556 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 1246 (L1246R)
Ref Sequence ENSEMBL: ENSMUSP00000028799 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028799] [ENSMUST00000028802] [ENSMUST00000099542] [ENSMUST00000152380]
Predicted Effect probably benign
Transcript: ENSMUST00000028799
AA Change: L1246R

PolyPhen 2 Score 0.133 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000028799
Gene: ENSMUSG00000027326
AA Change: L1246R

DomainStartEndE-ValueType
low complexity region 49 58 N/A INTRINSIC
PDB:4A1G|H 126 175 1e-13 PDB
low complexity region 426 433 N/A INTRINSIC
low complexity region 883 894 N/A INTRINSIC
low complexity region 1148 1159 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000028802
AA Change: L1246R

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000028802
Gene: ENSMUSG00000027326
AA Change: L1246R

DomainStartEndE-ValueType
low complexity region 49 58 N/A INTRINSIC
internal_repeat_1 98 304 1.57e-6 PROSPERO
low complexity region 426 433 N/A INTRINSIC
internal_repeat_1 610 824 1.57e-6 PROSPERO
low complexity region 883 894 N/A INTRINSIC
low complexity region 1148 1159 N/A INTRINSIC
low complexity region 1621 1644 N/A INTRINSIC
coiled coil region 1724 1755 N/A INTRINSIC
low complexity region 1836 1850 N/A INTRINSIC
low complexity region 1864 1878 N/A INTRINSIC
PDB:4NF9|B 1899 2119 1e-115 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000099542
AA Change: L1246R

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000097140
Gene: ENSMUSG00000027326
AA Change: L1246R

DomainStartEndE-ValueType
low complexity region 49 58 N/A INTRINSIC
internal_repeat_1 98 304 1.57e-6 PROSPERO
low complexity region 426 433 N/A INTRINSIC
internal_repeat_1 610 824 1.57e-6 PROSPERO
low complexity region 883 894 N/A INTRINSIC
low complexity region 1148 1159 N/A INTRINSIC
low complexity region 1621 1644 N/A INTRINSIC
coiled coil region 1724 1755 N/A INTRINSIC
low complexity region 1836 1850 N/A INTRINSIC
low complexity region 1864 1878 N/A INTRINSIC
PDB:4NF9|B 1899 2119 1e-115 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000152380
SMART Domains Protein: ENSMUSP00000118646
Gene: ENSMUSG00000027326

DomainStartEndE-ValueType
low complexity region 49 58 N/A INTRINSIC
PDB:4A1G|H 126 175 3e-14 PDB
low complexity region 426 433 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 96% (55/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the multiprotein assembly that is required for creation of kinetochore-microtubule attachments and chromosome segregation. The encoded protein functions as a scaffold for proteins that influence the spindle assembly checkpoint during the eukaryotic cell cycle and it interacts with at least five different kinetochore proteins and two checkpoint kinases. In adults, this gene is predominantly expressed in normal testes, various cancer cell lines and primary tumors from other tissues and is ubiquitously expressed in fetal tissues. This gene was originally identified as a fusion partner with the mixed-lineage leukemia (MLL) gene in t(11;15)(q23;q14). Mutations in this gene cause autosomal recessive primary microcephaly-4 (MCPH4). Alternative splicing results in multiple transcript variants encoding different isoforms. Additional splice variants have been described but their biological validity has not been confirmed. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E6. Mice homozygous for an ENU-induced allele exhibit possible embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadac A C 3: 60,038,472 S188R probably damaging Het
Aars T A 8: 111,041,657 I220N probably damaging Het
Abca15 A G 7: 120,332,217 N16S probably damaging Het
Adck1 A T 12: 88,456,800 M358L probably benign Het
Adck5 A T 15: 76,594,548 Q345L probably benign Het
Adgrl2 A G 3: 148,836,458 F876S probably damaging Het
Aebp2 T A 6: 140,623,858 L55Q unknown Het
Ampd2 C A 3: 108,080,116 V134L probably benign Het
Aox3 T C 1: 58,176,517 V1036A possibly damaging Het
Aox4 A G 1: 58,240,707 D494G probably benign Het
Cacna1a C A 8: 84,559,394 H889Q probably benign Het
Cacna1c T C 6: 119,052,626 D151G Het
Car8 A G 4: 8,237,939 V92A possibly damaging Het
Ccdc8 G T 7: 16,995,689 A368S unknown Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Cfap57 C T 4: 118,614,931 V84I probably benign Het
Cntnap5a A G 1: 116,442,283 I877V probably benign Het
Copa A T 1: 172,111,942 D582V probably damaging Het
Cpne2 T G 8: 94,568,684 S466A probably damaging Het
Crybg2 A G 4: 134,088,845 K1311R possibly damaging Het
Csmd1 A G 8: 15,932,461 probably null Het
Dnah2 A T 11: 69,451,318 C2947* probably null Het
Exoc1 A T 5: 76,561,512 K656* probably null Het
Exoc8 T C 8: 124,895,819 N603S probably benign Het
Fam171a1 T A 2: 3,225,446 C539S possibly damaging Het
Fastkd5 A T 2: 130,615,068 I534K probably damaging Het
Fbn1 T C 2: 125,303,195 D2708G probably benign Het
Fhad1 A G 4: 141,890,939 L1392P probably benign Het
Fras1 A T 5: 96,726,895 T2306S probably benign Het
Gdf7 G T 12: 8,301,854 A27E unknown Het
Hnrnph1 A T 11: 50,379,497 I43F probably damaging Het
Igkv8-27 T A 6: 70,172,015 S52C probably benign Het
Jmjd1c T C 10: 67,217,045 F24L probably damaging Het
Limk2 C T 11: 3,355,896 S191N probably damaging Het
Mdga2 G A 12: 66,689,350 A368V probably damaging Het
Mdga2 C A 12: 66,689,351 A368S possibly damaging Het
Med24 A T 11: 98,704,967 L966Q probably damaging Het
Mgll T C 6: 88,725,788 V23A possibly damaging Het
Nedd1 C T 10: 92,714,172 D84N probably benign Het
Obscn A C 11: 59,060,855 L4024R probably damaging Het
Olfr172 A T 16: 58,760,419 Y252* probably null Het
Pcnx2 T C 8: 125,851,107 I944V probably benign Het
Pecr T C 1: 72,266,998 probably null Het
Phf3 A T 1: 30,804,224 W1885R probably damaging Het
Pitpnm2 C G 5: 124,128,705 A697P probably benign Het
Piwil2 T A 14: 70,394,189 H602L probably benign Het
Pprc1 T C 19: 46,065,342 S1104P unknown Het
Prkar1a T A 11: 109,653,847 Y21* probably null Het
Prl2c3 A T 13: 12,798,297 Y9* probably null Het
Rhbdl3 T A 11: 80,323,579 L172Q possibly damaging Het
Rsph3a T G 17: 7,979,243 L484W probably damaging Het
Sbno1 A T 5: 124,392,899 S809T probably benign Het
Stmnd1 T A 13: 46,299,601 V251E possibly damaging Het
Stt3a A T 9: 36,751,239 C241* probably null Het
Tas2r114 A T 6: 131,689,438 M209K probably damaging Het
Tchh G T 3: 93,444,777 R508L unknown Het
Tgfbr3l T C 8: 4,250,622 S267P possibly damaging Het
Ttn T A 2: 76,767,800 I19590F probably damaging Het
Vmn1r171 A G 7: 23,632,610 T87A probably benign Het
Other mutations in Knl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Knl1 APN 2 119064083 missense probably damaging 0.96
IGL00582:Knl1 APN 2 119102499 missense probably benign 0.19
IGL00666:Knl1 APN 2 119070464 missense probably damaging 0.96
IGL01062:Knl1 APN 2 119076980 missense probably benign 0.33
IGL01395:Knl1 APN 2 119071566 missense probably damaging 0.96
IGL01604:Knl1 APN 2 119070001 missense probably damaging 1.00
IGL01996:Knl1 APN 2 119104061 missense probably damaging 1.00
IGL02086:Knl1 APN 2 119100774 missense probably benign 0.40
IGL02105:Knl1 APN 2 119071808 missense probably benign
IGL02106:Knl1 APN 2 119072008 missense possibly damaging 0.89
IGL02201:Knl1 APN 2 119069152 missense probably benign 0.01
IGL02252:Knl1 APN 2 119072540 missense probably damaging 1.00
IGL02414:Knl1 APN 2 119070323 missense possibly damaging 0.83
IGL02655:Knl1 APN 2 119070992 missense possibly damaging 0.62
IGL02682:Knl1 APN 2 119077969 missense possibly damaging 0.86
IGL02710:Knl1 APN 2 119070930 missense probably damaging 0.99
IGL02877:Knl1 APN 2 119088831 missense probably benign 0.08
IGL03100:Knl1 APN 2 119100770 missense probably damaging 0.99
IGL03210:Knl1 APN 2 119070617 missense probably benign 0.02
IGL03138:Knl1 UTSW 2 119072359 missense probably damaging 0.96
R0023:Knl1 UTSW 2 119102549 missense possibly damaging 0.73
R0064:Knl1 UTSW 2 119076243 missense probably benign 0.00
R0064:Knl1 UTSW 2 119076243 missense probably benign 0.00
R0078:Knl1 UTSW 2 119069892 missense probably benign 0.16
R0178:Knl1 UTSW 2 119058405 splice site probably benign
R0295:Knl1 UTSW 2 119088839 missense probably damaging 1.00
R0433:Knl1 UTSW 2 119104061 missense probably damaging 0.96
R0453:Knl1 UTSW 2 119068388 missense probably damaging 1.00
R0569:Knl1 UTSW 2 119097435 missense possibly damaging 0.95
R0827:Knl1 UTSW 2 119088901 splice site probably benign
R0920:Knl1 UTSW 2 119069828 missense probably benign 0.00
R1120:Knl1 UTSW 2 119062375 missense probably damaging 0.99
R1155:Knl1 UTSW 2 119071154 missense possibly damaging 0.90
R1204:Knl1 UTSW 2 119071189 missense probably benign 0.00
R1241:Knl1 UTSW 2 119072573 missense probably benign 0.03
R1387:Knl1 UTSW 2 119070730 missense possibly damaging 0.93
R1448:Knl1 UTSW 2 119068307 missense probably damaging 1.00
R1469:Knl1 UTSW 2 119071346 missense possibly damaging 0.73
R1469:Knl1 UTSW 2 119071346 missense possibly damaging 0.73
R1719:Knl1 UTSW 2 119071738 missense probably benign 0.01
R1721:Knl1 UTSW 2 119076334 missense probably damaging 1.00
R2128:Knl1 UTSW 2 119071819 missense possibly damaging 0.79
R2170:Knl1 UTSW 2 119087594 critical splice donor site probably null
R2227:Knl1 UTSW 2 119072000 missense probably damaging 0.97
R2246:Knl1 UTSW 2 119072227 missense probably damaging 1.00
R2275:Knl1 UTSW 2 119072281 missense probably damaging 0.99
R2508:Knl1 UTSW 2 119058368 nonsense probably null
R3115:Knl1 UTSW 2 119070391 missense possibly damaging 0.53
R3122:Knl1 UTSW 2 119068944 missense probably benign 0.32
R3431:Knl1 UTSW 2 119062362 missense probably damaging 1.00
R3755:Knl1 UTSW 2 119102579 missense probably damaging 1.00
R4461:Knl1 UTSW 2 119059599 missense probably benign 0.00
R4600:Knl1 UTSW 2 119070544 missense possibly damaging 0.90
R4713:Knl1 UTSW 2 119069137 nonsense probably null
R4758:Knl1 UTSW 2 119071732 frame shift probably null
R4762:Knl1 UTSW 2 119071936 missense probably benign 0.01
R4869:Knl1 UTSW 2 119072351 missense possibly damaging 0.73
R4870:Knl1 UTSW 2 119081513 missense probably benign 0.22
R4935:Knl1 UTSW 2 119068957 missense possibly damaging 0.50
R5167:Knl1 UTSW 2 119070031 missense probably damaging 1.00
R5184:Knl1 UTSW 2 119069176 missense probably damaging 1.00
R5293:Knl1 UTSW 2 119069695 missense probably damaging 0.99
R5326:Knl1 UTSW 2 119068348 missense possibly damaging 0.66
R5331:Knl1 UTSW 2 119070255 missense possibly damaging 0.92
R5353:Knl1 UTSW 2 119070983 missense probably benign 0.01
R5493:Knl1 UTSW 2 119068730 missense probably damaging 0.98
R5542:Knl1 UTSW 2 119068348 missense possibly damaging 0.66
R5632:Knl1 UTSW 2 119070352 missense probably damaging 1.00
R5650:Knl1 UTSW 2 119081550 nonsense probably null
R5854:Knl1 UTSW 2 119070403 missense probably benign 0.02
R5979:Knl1 UTSW 2 119069360 missense possibly damaging 0.83
R6086:Knl1 UTSW 2 119094068 missense probably damaging 1.00
R6283:Knl1 UTSW 2 119070286 missense probably damaging 1.00
R6285:Knl1 UTSW 2 119071941 missense probably damaging 1.00
R6313:Knl1 UTSW 2 119069318 missense probably damaging 1.00
R6419:Knl1 UTSW 2 119069003 missense probably benign 0.02
R6608:Knl1 UTSW 2 119086612 missense probably damaging 0.99
R6881:Knl1 UTSW 2 119095184 missense possibly damaging 0.67
R7161:Knl1 UTSW 2 119070785 missense possibly damaging 0.79
R7206:Knl1 UTSW 2 119069299 missense probably benign 0.35
R7270:Knl1 UTSW 2 119102522 missense possibly damaging 0.53
R7276:Knl1 UTSW 2 119071686 missense probably damaging 0.98
R7358:Knl1 UTSW 2 119070559 missense possibly damaging 0.92
R7402:Knl1 UTSW 2 119095226 nonsense probably null
R7408:Knl1 UTSW 2 119070592 missense possibly damaging 0.54
R7475:Knl1 UTSW 2 119087546 missense probably damaging 1.00
R7516:Knl1 UTSW 2 119070698 missense probably damaging 0.99
R7524:Knl1 UTSW 2 119065979 missense probably damaging 1.00
R7559:Knl1 UTSW 2 119094006 missense possibly damaging 0.84
R7607:Knl1 UTSW 2 119095133 missense possibly damaging 0.93
R7847:Knl1 UTSW 2 119070976 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AGAAAGCTTATAATTGCCAAGTGCC -3'
(R):5'- GGATGCAGCGACATTTTCTAG -3'

Sequencing Primer
(F):5'- GCCAAGTGCCAAATGAATTTAC -3'
(R):5'- CTTCATCTCTACGGGCAA -3'
Posted On2019-11-26