Incidental Mutation 'R7745:Ampd2'
ID596777
Institutional Source Beutler Lab
Gene Symbol Ampd2
Ensembl Gene ENSMUSG00000027889
Gene Nameadenosine monophosphate deaminase 2
Synonyms1200014F01Rik, Ampd-2
MMRRC Submission
Accession Numbers

Genbank: NM_028779; MGI: 88016

Is this an essential gene? Probably non essential (E-score: 0.185) question?
Stock #R7745 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location108074062-108086651 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 108080116 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 134 (V134L)
Ref Sequence ENSEMBL: ENSMUSP00000099698 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078912] [ENSMUST00000102637] [ENSMUST00000102638]
Predicted Effect probably benign
Transcript: ENSMUST00000078912
AA Change: V160L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000077946
Gene: ENSMUSG00000027889
AA Change: V160L

DomainStartEndE-ValueType
low complexity region 99 111 N/A INTRINSIC
Pfam:A_deaminase 357 764 3.3e-137 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102637
AA Change: V134L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000099697
Gene: ENSMUSG00000027889
AA Change: V134L

DomainStartEndE-ValueType
low complexity region 73 85 N/A INTRINSIC
Pfam:A_deaminase 331 738 7.5e-125 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102638
AA Change: V134L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000099698
Gene: ENSMUSG00000027889
AA Change: V134L

DomainStartEndE-ValueType
low complexity region 73 85 N/A INTRINSIC
Pfam:A_deaminase 331 738 7.5e-125 PFAM
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 96% (55/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is important in purine metabolism by converting AMP to IMP. The encoded protein, which acts as a homotetramer, is one of three AMP deaminases found in mammals. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit proteinuria, tubules filled with protein casts and podocyte process effacement. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Gene trapped(5)

Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadac A C 3: 60,038,472 S188R probably damaging Het
Aars T A 8: 111,041,657 I220N probably damaging Het
Abca15 A G 7: 120,332,217 N16S probably damaging Het
Adck1 A T 12: 88,456,800 M358L probably benign Het
Adck5 A T 15: 76,594,548 Q345L probably benign Het
Adgrl2 A G 3: 148,836,458 F876S probably damaging Het
Aebp2 T A 6: 140,623,858 L55Q unknown Het
Aox3 T C 1: 58,176,517 V1036A possibly damaging Het
Aox4 A G 1: 58,240,707 D494G probably benign Het
Cacna1a C A 8: 84,559,394 H889Q probably benign Het
Cacna1c T C 6: 119,052,626 D151G Het
Car8 A G 4: 8,237,939 V92A possibly damaging Het
Ccdc8 G T 7: 16,995,689 A368S unknown Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Cfap57 C T 4: 118,614,931 V84I probably benign Het
Cntnap5a A G 1: 116,442,283 I877V probably benign Het
Copa A T 1: 172,111,942 D582V probably damaging Het
Cpne2 T G 8: 94,568,684 S466A probably damaging Het
Crybg2 A G 4: 134,088,845 K1311R possibly damaging Het
Csmd1 A G 8: 15,932,461 probably null Het
Dnah2 A T 11: 69,451,318 C2947* probably null Het
Exoc1 A T 5: 76,561,512 K656* probably null Het
Exoc8 T C 8: 124,895,819 N603S probably benign Het
Fam171a1 T A 2: 3,225,446 C539S possibly damaging Het
Fastkd5 A T 2: 130,615,068 I534K probably damaging Het
Fbn1 T C 2: 125,303,195 D2708G probably benign Het
Fhad1 A G 4: 141,890,939 L1392P probably benign Het
Fras1 A T 5: 96,726,895 T2306S probably benign Het
Gdf7 G T 12: 8,301,854 A27E unknown Het
Hnrnph1 A T 11: 50,379,497 I43F probably damaging Het
Igkv8-27 T A 6: 70,172,015 S52C probably benign Het
Jmjd1c T C 10: 67,217,045 F24L probably damaging Het
Knl1 T G 2: 119,071,556 L1246R probably benign Het
Limk2 C T 11: 3,355,896 S191N probably damaging Het
Mdga2 G A 12: 66,689,350 A368V probably damaging Het
Mdga2 C A 12: 66,689,351 A368S possibly damaging Het
Med24 A T 11: 98,704,967 L966Q probably damaging Het
Mgll T C 6: 88,725,788 V23A possibly damaging Het
Nedd1 C T 10: 92,714,172 D84N probably benign Het
Obscn A C 11: 59,060,855 L4024R probably damaging Het
Olfr172 A T 16: 58,760,419 Y252* probably null Het
Pcnx2 T C 8: 125,851,107 I944V probably benign Het
Pecr T C 1: 72,266,998 probably null Het
Phf3 A T 1: 30,804,224 W1885R probably damaging Het
Pitpnm2 C G 5: 124,128,705 A697P probably benign Het
Piwil2 T A 14: 70,394,189 H602L probably benign Het
Pprc1 T C 19: 46,065,342 S1104P unknown Het
Prkar1a T A 11: 109,653,847 Y21* probably null Het
Prl2c3 A T 13: 12,798,297 Y9* probably null Het
Rhbdl3 T A 11: 80,323,579 L172Q possibly damaging Het
Rsph3a T G 17: 7,979,243 L484W probably damaging Het
Sbno1 A T 5: 124,392,899 S809T probably benign Het
Stmnd1 T A 13: 46,299,601 V251E possibly damaging Het
Stt3a A T 9: 36,751,239 C241* probably null Het
Tas2r114 A T 6: 131,689,438 M209K probably damaging Het
Tchh G T 3: 93,444,777 R508L unknown Het
Tgfbr3l T C 8: 4,250,622 S267P possibly damaging Het
Ttn T A 2: 76,767,800 I19590F probably damaging Het
Vmn1r171 A G 7: 23,632,610 T87A probably benign Het
Other mutations in Ampd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Ampd2 APN 3 108077396 missense probably damaging 1.00
IGL02142:Ampd2 APN 3 108080344 splice site probably benign
IGL02174:Ampd2 APN 3 108080285 missense probably damaging 0.96
IGL02686:Ampd2 APN 3 108076495 missense possibly damaging 0.62
IGL03326:Ampd2 APN 3 108079287 missense probably benign 0.02
IGL03493:Ampd2 APN 3 108075358 missense probably damaging 1.00
D4186:Ampd2 UTSW 3 108081111 missense probably benign 0.00
H8562:Ampd2 UTSW 3 108081111 missense probably benign 0.00
PIT4445001:Ampd2 UTSW 3 108075012 missense probably damaging 1.00
R0271:Ampd2 UTSW 3 108086716 unclassified probably benign
R0835:Ampd2 UTSW 3 108076502 missense possibly damaging 0.48
R0975:Ampd2 UTSW 3 108077121 missense probably damaging 1.00
R1061:Ampd2 UTSW 3 108075689 missense probably damaging 1.00
R1466:Ampd2 UTSW 3 108080337 critical splice acceptor site probably null
R1466:Ampd2 UTSW 3 108080337 critical splice acceptor site probably null
R1584:Ampd2 UTSW 3 108080337 critical splice acceptor site probably null
R2034:Ampd2 UTSW 3 108077363 missense possibly damaging 0.91
R2164:Ampd2 UTSW 3 108085369 intron probably benign
R3040:Ampd2 UTSW 3 108076416 missense probably damaging 1.00
R3052:Ampd2 UTSW 3 108086487 utr 5 prime probably benign
R4329:Ampd2 UTSW 3 108077787 intron probably benign
R4425:Ampd2 UTSW 3 108086736 unclassified probably benign
R5073:Ampd2 UTSW 3 108079233 missense probably damaging 0.99
R5074:Ampd2 UTSW 3 108079233 missense probably damaging 0.99
R5180:Ampd2 UTSW 3 108079042 missense probably benign 0.00
R5256:Ampd2 UTSW 3 108079549 intron probably benign
R5507:Ampd2 UTSW 3 108077613 missense probably damaging 1.00
R5513:Ampd2 UTSW 3 108075667 missense possibly damaging 0.85
R5955:Ampd2 UTSW 3 108079772 missense probably damaging 1.00
R6941:Ampd2 UTSW 3 108079293 missense probably damaging 0.99
R7744:Ampd2 UTSW 3 108080116 missense probably benign
R7815:Ampd2 UTSW 3 108074931 missense probably benign 0.06
R7938:Ampd2 UTSW 3 108080116 missense probably benign
R7939:Ampd2 UTSW 3 108080116 missense probably benign
R7941:Ampd2 UTSW 3 108080116 missense probably benign
R7942:Ampd2 UTSW 3 108080116 missense probably benign
R8309:Ampd2 UTSW 3 108080116 missense probably benign
R8312:Ampd2 UTSW 3 108080116 missense probably benign
R8503:Ampd2 UTSW 3 108080116 missense probably benign
R8518:Ampd2 UTSW 3 108080116 missense probably benign
Z1176:Ampd2 UTSW 3 108080064 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGGTCCCAGAGAATCAGTG -3'
(R):5'- CTTCGAGCCAAGCAAGATTTCC -3'

Sequencing Primer
(F):5'- GTCCCAGAGAATCAGTGAGCCC -3'
(R):5'- TTTCCTGAAGACAGACAGCG -3'
Posted On2019-11-26