Incidental Mutation 'R7745:Adgrl2'
ID596778
Institutional Source Beutler Lab
Gene Symbol Adgrl2
Ensembl Gene ENSMUSG00000028184
Gene Nameadhesion G protein-coupled receptor L2
SynonymsLec1, Lphn2, Lphh1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7745 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location148815583-148990555 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 148836458 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 876 (F876S)
Ref Sequence ENSEMBL: ENSMUSP00000143626 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106128] [ENSMUST00000195988] [ENSMUST00000196526] [ENSMUST00000197567] [ENSMUST00000198779] [ENSMUST00000199059] [ENSMUST00000199238] [ENSMUST00000199750] [ENSMUST00000200154] [ENSMUST00000200543]
Predicted Effect probably damaging
Transcript: ENSMUST00000106128
AA Change: F876S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101734
Gene: ENSMUSG00000028184
AA Change: F876S

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Gal_Lectin 49 129 2.5e-26 PFAM
OLF 142 398 5.22e-140 SMART
HormR 469 534 3.14e-20 SMART
Pfam:GAIN 537 764 1.3e-58 PFAM
GPS 788 840 3.47e-25 SMART
Pfam:7tm_2 848 1108 4.6e-69 PFAM
Pfam:Latrophilin 1128 1487 6.4e-181 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000195988
AA Change: F876S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143444
Gene: ENSMUSG00000028184
AA Change: F876S

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Gal_Lectin 49 129 3.3e-23 PFAM
OLF 142 398 3.3e-142 SMART
HormR 469 534 2e-22 SMART
GPS 788 840 2.1e-27 SMART
Pfam:7tm_2 848 1099 8.1e-66 PFAM
Pfam:Latrophilin 1119 1189 2.2e-28 PFAM
Pfam:Latrophilin 1184 1435 5.5e-123 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000196526
AA Change: F859S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000143788
Gene: ENSMUSG00000028184
AA Change: F859S

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Gal_Lectin 49 129 8.7e-24 PFAM
OLF 138 394 3.4e-142 SMART
HormR 465 530 2e-22 SMART
Pfam:GAIN 533 747 1.1e-54 PFAM
GPS 771 823 2.2e-27 SMART
Pfam:7tm_2 831 1067 6.5e-68 PFAM
Pfam:Latrophilin 1087 1158 9.9e-36 PFAM
low complexity region 1163 1173 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197348
Predicted Effect probably damaging
Transcript: ENSMUST00000197567
AA Change: F876S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143626
Gene: ENSMUSG00000028184
AA Change: F876S

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Gal_Lectin 49 129 1.9e-26 PFAM
OLF 142 398 5.22e-140 SMART
HormR 469 534 3.14e-20 SMART
Pfam:GAIN 537 764 1.1e-58 PFAM
GPS 788 840 3.47e-25 SMART
Pfam:7tm_2 848 1108 6.4e-69 PFAM
Pfam:Latrophilin 1128 1487 2.8e-181 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197925
Predicted Effect possibly damaging
Transcript: ENSMUST00000198779
AA Change: F876S

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000142347
Gene: ENSMUSG00000028184
AA Change: F876S

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Gal_Lectin 49 129 3.4e-23 PFAM
OLF 142 398 3.3e-142 SMART
HormR 469 534 2e-22 SMART
GPS 788 840 2.1e-27 SMART
Pfam:7tm_2 848 1084 1.8e-66 PFAM
Pfam:Latrophilin 1104 1452 7e-174 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000199059
AA Change: F876S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143150
Gene: ENSMUSG00000028184
AA Change: F876S

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Gal_Lectin 49 129 3.4e-23 PFAM
OLF 142 398 3.3e-142 SMART
HormR 469 534 2e-22 SMART
GPS 788 840 2.1e-27 SMART
Pfam:7tm_2 848 1099 8.3e-66 PFAM
Pfam:Latrophilin 1119 1467 7.1e-174 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000199238
AA Change: F876S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142405
Gene: ENSMUSG00000028184
AA Change: F876S

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Gal_Lectin 49 129 3.4e-23 PFAM
OLF 142 398 3.3e-142 SMART
HormR 469 534 2e-22 SMART
GPS 788 840 2.1e-27 SMART
Pfam:7tm_2 848 1099 8.4e-66 PFAM
Pfam:Latrophilin 1119 1478 1.6e-187 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000199750
AA Change: F797S

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000143320
Gene: ENSMUSG00000028184
AA Change: F797S

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Gal_Lectin 49 129 3.1e-23 PFAM
OLF 142 398 3.3e-142 SMART
HormR 403 468 1.9e-22 SMART
GPS 709 761 2.1e-27 SMART
Pfam:7tm_2 769 1005 1.6e-66 PFAM
Pfam:Latrophilin 1025 1095 2e-28 PFAM
Pfam:Latrophilin 1090 1341 4.9e-123 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000200154
AA Change: F859S

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000142865
Gene: ENSMUSG00000028184
AA Change: F859S

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Gal_Lectin 49 129 2.5e-23 PFAM
OLF 138 394 3.3e-142 SMART
HormR 465 530 2e-22 SMART
GPS 771 823 2.1e-27 SMART
Pfam:7tm_2 831 1067 1.2e-66 PFAM
Pfam:Latrophilin 1087 1123 2.2e-4 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000200543
AA Change: F859S

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000142336
Gene: ENSMUSG00000028184
AA Change: F859S

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Gal_Lectin 49 129 3.2e-23 PFAM
OLF 138 394 3.3e-142 SMART
HormR 465 530 2e-22 SMART
GPS 771 823 2.1e-27 SMART
Pfam:7tm_2 831 1067 1.7e-66 PFAM
Pfam:Latrophilin 1087 1157 2.1e-28 PFAM
Pfam:Latrophilin 1152 1403 5.3e-123 PFAM
Meta Mutation Damage Score 0.6632 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 96% (55/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the latrophilin subfamily of G-protein coupled receptors. The encoded protein participates in the regulation of exocytosis. The proprotein is thought to be further cleaved within a cysteine-rich G-protein-coupled receptor proteolysis site into two chains that are non-covalently bound at the cell membrane. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Homozygous null mice die prenatally at fetal stages. Heterozygous mice exhibit decreased locomotor activity in an open field test. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadac A C 3: 60,038,472 S188R probably damaging Het
Aars T A 8: 111,041,657 I220N probably damaging Het
Abca15 A G 7: 120,332,217 N16S probably damaging Het
Adck1 A T 12: 88,456,800 M358L probably benign Het
Adck5 A T 15: 76,594,548 Q345L probably benign Het
Aebp2 T A 6: 140,623,858 L55Q unknown Het
Ampd2 C A 3: 108,080,116 V134L probably benign Het
Aox3 T C 1: 58,176,517 V1036A possibly damaging Het
Aox4 A G 1: 58,240,707 D494G probably benign Het
Cacna1a C A 8: 84,559,394 H889Q probably benign Het
Cacna1c T C 6: 119,052,626 D151G Het
Car8 A G 4: 8,237,939 V92A possibly damaging Het
Ccdc8 G T 7: 16,995,689 A368S unknown Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Cfap57 C T 4: 118,614,931 V84I probably benign Het
Cntnap5a A G 1: 116,442,283 I877V probably benign Het
Copa A T 1: 172,111,942 D582V probably damaging Het
Cpne2 T G 8: 94,568,684 S466A probably damaging Het
Crybg2 A G 4: 134,088,845 K1311R possibly damaging Het
Csmd1 A G 8: 15,932,461 probably null Het
Dnah2 A T 11: 69,451,318 C2947* probably null Het
Exoc1 A T 5: 76,561,512 K656* probably null Het
Exoc8 T C 8: 124,895,819 N603S probably benign Het
Fam171a1 T A 2: 3,225,446 C539S possibly damaging Het
Fastkd5 A T 2: 130,615,068 I534K probably damaging Het
Fbn1 T C 2: 125,303,195 D2708G probably benign Het
Fhad1 A G 4: 141,890,939 L1392P probably benign Het
Fras1 A T 5: 96,726,895 T2306S probably benign Het
Gdf7 G T 12: 8,301,854 A27E unknown Het
Hnrnph1 A T 11: 50,379,497 I43F probably damaging Het
Igkv8-27 T A 6: 70,172,015 S52C probably benign Het
Jmjd1c T C 10: 67,217,045 F24L probably damaging Het
Knl1 T G 2: 119,071,556 L1246R probably benign Het
Limk2 C T 11: 3,355,896 S191N probably damaging Het
Mdga2 G A 12: 66,689,350 A368V probably damaging Het
Mdga2 C A 12: 66,689,351 A368S possibly damaging Het
Med24 A T 11: 98,704,967 L966Q probably damaging Het
Mgll T C 6: 88,725,788 V23A possibly damaging Het
Nedd1 C T 10: 92,714,172 D84N probably benign Het
Obscn A C 11: 59,060,855 L4024R probably damaging Het
Olfr172 A T 16: 58,760,419 Y252* probably null Het
Pcnx2 T C 8: 125,851,107 I944V probably benign Het
Pecr T C 1: 72,266,998 probably null Het
Phf3 A T 1: 30,804,224 W1885R probably damaging Het
Pitpnm2 C G 5: 124,128,705 A697P probably benign Het
Piwil2 T A 14: 70,394,189 H602L probably benign Het
Pprc1 T C 19: 46,065,342 S1104P unknown Het
Prkar1a T A 11: 109,653,847 Y21* probably null Het
Prl2c3 A T 13: 12,798,297 Y9* probably null Het
Rhbdl3 T A 11: 80,323,579 L172Q possibly damaging Het
Rsph3a T G 17: 7,979,243 L484W probably damaging Het
Sbno1 A T 5: 124,392,899 S809T probably benign Het
Stmnd1 T A 13: 46,299,601 V251E possibly damaging Het
Stt3a A T 9: 36,751,239 C241* probably null Het
Tas2r114 A T 6: 131,689,438 M209K probably damaging Het
Tchh G T 3: 93,444,777 R508L unknown Het
Tgfbr3l T C 8: 4,250,622 S267P possibly damaging Het
Ttn T A 2: 76,767,800 I19590F probably damaging Het
Vmn1r171 A G 7: 23,632,610 T87A probably benign Het
Other mutations in Adgrl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00426:Adgrl2 APN 3 148865608 missense probably damaging 0.99
IGL00572:Adgrl2 APN 3 148826498 missense probably damaging 1.00
IGL01624:Adgrl2 APN 3 148836527 missense probably damaging 1.00
IGL01796:Adgrl2 APN 3 148858975 missense probably damaging 1.00
IGL02380:Adgrl2 APN 3 148828489 nonsense probably null
IGL02468:Adgrl2 APN 3 148890480 missense probably damaging 1.00
IGL02708:Adgrl2 APN 3 148826525 missense probably damaging 0.96
IGL02869:Adgrl2 APN 3 148890605 missense probably damaging 1.00
IGL03248:Adgrl2 APN 3 148817400 missense probably damaging 1.00
IGL03343:Adgrl2 APN 3 148859380 missense probably damaging 0.98
P0157:Adgrl2 UTSW 3 148859063 missense probably damaging 1.00
PIT4382001:Adgrl2 UTSW 3 148817298 missense
PIT4544001:Adgrl2 UTSW 3 148890521 missense probably damaging 1.00
R0165:Adgrl2 UTSW 3 148852863 splice site probably benign
R0242:Adgrl2 UTSW 3 148839185 splice site probably null
R0242:Adgrl2 UTSW 3 148839185 splice site probably null
R0344:Adgrl2 UTSW 3 148865595 splice site probably null
R0488:Adgrl2 UTSW 3 148846905 missense probably damaging 1.00
R0542:Adgrl2 UTSW 3 148859218 missense probably damaging 1.00
R0630:Adgrl2 UTSW 3 148839244 missense probably damaging 0.98
R0674:Adgrl2 UTSW 3 148837679 missense possibly damaging 0.91
R1401:Adgrl2 UTSW 3 148822981 missense probably damaging 0.99
R1543:Adgrl2 UTSW 3 148859273 missense probably damaging 1.00
R1575:Adgrl2 UTSW 3 148852762 missense probably benign 0.17
R1645:Adgrl2 UTSW 3 148865608 missense probably damaging 1.00
R1780:Adgrl2 UTSW 3 148852593 missense probably damaging 1.00
R1992:Adgrl2 UTSW 3 148817244 missense possibly damaging 0.89
R2014:Adgrl2 UTSW 3 148826475 missense probably damaging 1.00
R2130:Adgrl2 UTSW 3 148890488 missense probably damaging 0.99
R2131:Adgrl2 UTSW 3 148890488 missense probably damaging 0.99
R2400:Adgrl2 UTSW 3 148851934 missense probably damaging 1.00
R2997:Adgrl2 UTSW 3 148817649 missense probably damaging 1.00
R3161:Adgrl2 UTSW 3 148817551 missense probably damaging 1.00
R3416:Adgrl2 UTSW 3 148859329 missense probably damaging 1.00
R3417:Adgrl2 UTSW 3 148859329 missense probably damaging 1.00
R3551:Adgrl2 UTSW 3 148858963 missense probably damaging 1.00
R3760:Adgrl2 UTSW 3 148817235 missense probably damaging 1.00
R4355:Adgrl2 UTSW 3 148839152 missense probably damaging 1.00
R4850:Adgrl2 UTSW 3 148859020 missense probably damaging 1.00
R4911:Adgrl2 UTSW 3 148890463 missense probably damaging 0.99
R4945:Adgrl2 UTSW 3 148823036 missense probably damaging 0.99
R5313:Adgrl2 UTSW 3 148823713 missense probably damaging 1.00
R5339:Adgrl2 UTSW 3 148817844 missense probably benign 0.01
R5540:Adgrl2 UTSW 3 148837562 critical splice donor site probably null
R5583:Adgrl2 UTSW 3 148859164 missense probably damaging 1.00
R5890:Adgrl2 UTSW 3 148859175 missense probably damaging 1.00
R6170:Adgrl2 UTSW 3 148823009 missense probably damaging 1.00
R6197:Adgrl2 UTSW 3 148858942 missense probably damaging 1.00
R6284:Adgrl2 UTSW 3 148826507 missense probably damaging 1.00
R6877:Adgrl2 UTSW 3 148817286 missense probably damaging 1.00
R7048:Adgrl2 UTSW 3 148846929 missense probably damaging 1.00
R7205:Adgrl2 UTSW 3 148858949 missense probably damaging 1.00
R7326:Adgrl2 UTSW 3 148846870 missense probably benign 0.00
R7348:Adgrl2 UTSW 3 148817766 missense
R7382:Adgrl2 UTSW 3 148817283 missense
R7486:Adgrl2 UTSW 3 148817694 missense
R7498:Adgrl2 UTSW 3 148859216 nonsense probably null
R7644:Adgrl2 UTSW 3 148839153 missense probably damaging 1.00
R7690:Adgrl2 UTSW 3 148817298 missense
R7742:Adgrl2 UTSW 3 148836428 missense probably damaging 1.00
R8291:Adgrl2 UTSW 3 148850918 missense possibly damaging 0.93
R8326:Adgrl2 UTSW 3 148827554 missense
R8343:Adgrl2 UTSW 3 148846906 missense probably damaging 1.00
R8344:Adgrl2 UTSW 3 148859525 missense probably damaging 0.98
RF007:Adgrl2 UTSW 3 148839248 missense probably damaging 1.00
X0009:Adgrl2 UTSW 3 148852654 missense probably damaging 1.00
X0019:Adgrl2 UTSW 3 148865594 splice site probably null
Predicted Primers PCR Primer
(F):5'- ATCGCACGGATATCCACAGC -3'
(R):5'- ATCTATGGGCCTGTGTTTGAAC -3'

Sequencing Primer
(F):5'- CGGATATCCACAGCTAACGG -3'
(R):5'- TCATCAGACCCTTGGGTGGAAG -3'
Posted On2019-11-26