Incidental Mutation 'R7745:Car8'
ID596779
Institutional Source Beutler Lab
Gene Symbol Car8
Ensembl Gene ENSMUSG00000041261
Gene Namecarbonic anhydrase 8
SynonymsCA-RP VIII, Carp, Cals1, wdl
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R7745 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location8143362-8239041 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 8237939 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 92 (V92A)
Ref Sequence ENSEMBL: ENSMUSP00000063511 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066674]
Predicted Effect possibly damaging
Transcript: ENSMUST00000066674
AA Change: V92A

PolyPhen 2 Score 0.665 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000063511
Gene: ENSMUSG00000041261
AA Change: V92A

DomainStartEndE-ValueType
Carb_anhydrase 30 290 1.32e-110 SMART
Meta Mutation Damage Score 0.1937 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 96% (55/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene was initially named CA-related protein because of sequence similarity to other known carbonic anhydrase genes. However, the gene product lacks carbonic anhydrase activity (i.e., the reversible hydration of carbon dioxide). The gene product continues to carry a carbonic anhydrase designation based on clear sequence identity to other members of the carbonic anhydrase gene family. The absence of CA8 gene transcription in the cerebellum of the lurcher mutant in mice with a neurologic defect suggests an important role for this acatalytic form. Mutations in this gene are associated with cerebellar ataxia, mental retardation, and dysequilibrium syndrome 3 (CMARQ3). Polymorphisms in this gene are associated with osteoporosis, and overexpression of this gene in osteosarcoma cells suggests an oncogenic role. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a spontaneous deletion exhibit a wobbly side-to-side gait which is first noted at two weeks of age and persists throughout life. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadac A C 3: 60,038,472 S188R probably damaging Het
Aars T A 8: 111,041,657 I220N probably damaging Het
Abca15 A G 7: 120,332,217 N16S probably damaging Het
Adck1 A T 12: 88,456,800 M358L probably benign Het
Adck5 A T 15: 76,594,548 Q345L probably benign Het
Adgrl2 A G 3: 148,836,458 F876S probably damaging Het
Aebp2 T A 6: 140,623,858 L55Q unknown Het
Ampd2 C A 3: 108,080,116 V134L probably benign Het
Aox3 T C 1: 58,176,517 V1036A possibly damaging Het
Aox4 A G 1: 58,240,707 D494G probably benign Het
Cacna1a C A 8: 84,559,394 H889Q probably benign Het
Cacna1c T C 6: 119,052,626 D151G Het
Ccdc8 G T 7: 16,995,689 A368S unknown Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Cfap57 C T 4: 118,614,931 V84I probably benign Het
Cntnap5a A G 1: 116,442,283 I877V probably benign Het
Copa A T 1: 172,111,942 D582V probably damaging Het
Cpne2 T G 8: 94,568,684 S466A probably damaging Het
Crybg2 A G 4: 134,088,845 K1311R possibly damaging Het
Csmd1 A G 8: 15,932,461 probably null Het
Dnah2 A T 11: 69,451,318 C2947* probably null Het
Exoc1 A T 5: 76,561,512 K656* probably null Het
Exoc8 T C 8: 124,895,819 N603S probably benign Het
Fam171a1 T A 2: 3,225,446 C539S possibly damaging Het
Fastkd5 A T 2: 130,615,068 I534K probably damaging Het
Fbn1 T C 2: 125,303,195 D2708G probably benign Het
Fhad1 A G 4: 141,890,939 L1392P probably benign Het
Fras1 A T 5: 96,726,895 T2306S probably benign Het
Gdf7 G T 12: 8,301,854 A27E unknown Het
Hnrnph1 A T 11: 50,379,497 I43F probably damaging Het
Igkv8-27 T A 6: 70,172,015 S52C probably benign Het
Jmjd1c T C 10: 67,217,045 F24L probably damaging Het
Knl1 T G 2: 119,071,556 L1246R probably benign Het
Limk2 C T 11: 3,355,896 S191N probably damaging Het
Mdga2 G A 12: 66,689,350 A368V probably damaging Het
Mdga2 C A 12: 66,689,351 A368S possibly damaging Het
Med24 A T 11: 98,704,967 L966Q probably damaging Het
Mgll T C 6: 88,725,788 V23A possibly damaging Het
Nedd1 C T 10: 92,714,172 D84N probably benign Het
Obscn A C 11: 59,060,855 L4024R probably damaging Het
Olfr172 A T 16: 58,760,419 Y252* probably null Het
Pcnx2 T C 8: 125,851,107 I944V probably benign Het
Pecr T C 1: 72,266,998 probably null Het
Phf3 A T 1: 30,804,224 W1885R probably damaging Het
Pitpnm2 C G 5: 124,128,705 A697P probably benign Het
Piwil2 T A 14: 70,394,189 H602L probably benign Het
Pprc1 T C 19: 46,065,342 S1104P unknown Het
Prkar1a T A 11: 109,653,847 Y21* probably null Het
Prl2c3 A T 13: 12,798,297 Y9* probably null Het
Rhbdl3 T A 11: 80,323,579 L172Q possibly damaging Het
Rsph3a T G 17: 7,979,243 L484W probably damaging Het
Sbno1 A T 5: 124,392,899 S809T probably benign Het
Stmnd1 T A 13: 46,299,601 V251E possibly damaging Het
Stt3a A T 9: 36,751,239 C241* probably null Het
Tas2r114 A T 6: 131,689,438 M209K probably damaging Het
Tchh G T 3: 93,444,777 R508L unknown Het
Tgfbr3l T C 8: 4,250,622 S267P possibly damaging Het
Ttn T A 2: 76,767,800 I19590F probably damaging Het
Vmn1r171 A G 7: 23,632,610 T87A probably benign Het
Other mutations in Car8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00863:Car8 APN 4 8183251 critical splice donor site probably null
IGL01506:Car8 APN 4 8169761 missense probably damaging 0.98
IGL01679:Car8 APN 4 8169674 missense possibly damaging 0.73
IGL02364:Car8 APN 4 8183321 missense probably benign
IGL02698:Car8 APN 4 8185598 missense probably benign 0.01
R0723:Car8 UTSW 4 8169703 missense probably benign 0.03
R0893:Car8 UTSW 4 8238119 splice site probably null
R1451:Car8 UTSW 4 8189327 missense probably benign 0.09
R1676:Car8 UTSW 4 8185616 missense probably damaging 1.00
R1796:Car8 UTSW 4 8221671 nonsense probably null
R3849:Car8 UTSW 4 8189353 missense probably benign 0.14
R3915:Car8 UTSW 4 8184576 splice site probably benign
R4078:Car8 UTSW 4 8169731 missense possibly damaging 0.49
R4717:Car8 UTSW 4 8169685 missense probably damaging 1.00
R6484:Car8 UTSW 4 8189362 missense probably benign 0.11
R6981:Car8 UTSW 4 8185650 splice site probably null
R7832:Car8 UTSW 4 8238860 missense possibly damaging 0.95
R8459:Car8 UTSW 4 8189302 missense probably benign
Z1177:Car8 UTSW 4 8221594 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTTTTGGAAGAACAGCCAGC -3'
(R):5'- AACCTAGTCTCATTTTGTCTTCAGG -3'

Sequencing Primer
(F):5'- GCCAGCTGAGATAATCATCACTTC -3'
(R):5'- CTCATTTTGTCTTCAGGTGTTGAG -3'
Posted On2019-11-26