Incidental Mutation 'R7745:Mgll'
ID596789
Institutional Source Beutler Lab
Gene Symbol Mgll
Ensembl Gene ENSMUSG00000033174
Gene Namemonoglyceride lipase
SynonymsMagl
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.142) question?
Stock #R7745 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location88724412-88828360 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 88725788 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 23 (V23A)
Ref Sequence ENSEMBL: ENSMUSP00000109215 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089449] [ENSMUST00000113581] [ENSMUST00000113582] [ENSMUST00000113585] [ENSMUST00000150180] [ENSMUST00000163271] [ENSMUST00000203608] [ENSMUST00000203824]
Predicted Effect possibly damaging
Transcript: ENSMUST00000089449
AA Change: V23A

PolyPhen 2 Score 0.769 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000086872
Gene: ENSMUSG00000033174
AA Change: V23A

DomainStartEndE-ValueType
Pfam:Hydrolase_4 27 105 6e-29 PFAM
Pfam:Abhydrolase_5 43 270 1e-21 PFAM
Pfam:Abhydrolase_6 44 282 4.4e-26 PFAM
Pfam:DUF2305 55 186 1.7e-7 PFAM
Pfam:Lipase_3 56 163 1.6e-9 PFAM
Pfam:Abhydrolase_1 71 284 4.2e-14 PFAM
Pfam:Esterase 82 195 8.6e-8 PFAM
Pfam:Abhydrolase_3 88 273 8.8e-7 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000113581
AA Change: V23A

PolyPhen 2 Score 0.894 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000109211
Gene: ENSMUSG00000033174
AA Change: V23A

DomainStartEndE-ValueType
Pfam:Hydrolase_4 39 304 6.8e-70 PFAM
Pfam:Abhydrolase_5 43 298 1.1e-20 PFAM
Pfam:Abhydrolase_1 44 186 8.1e-13 PFAM
Pfam:Abhydrolase_6 44 310 4.4e-15 PFAM
Pfam:DUF2305 55 224 2.2e-8 PFAM
Pfam:Lipase_3 58 146 1.4e-8 PFAM
Pfam:Esterase 82 195 1.7e-7 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000113582
AA Change: V23A

PolyPhen 2 Score 0.545 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000109212
Gene: ENSMUSG00000033174
AA Change: V23A

DomainStartEndE-ValueType
Pfam:Hydrolase_4 27 105 4.4e-29 PFAM
Pfam:Abhydrolase_5 43 225 3.2e-18 PFAM
Pfam:Abhydrolase_6 44 184 1.3e-18 PFAM
Pfam:Lipase_3 55 163 1.2e-9 PFAM
Pfam:DUF2305 55 249 4.9e-8 PFAM
Pfam:Abhydrolase_1 71 220 1.1e-13 PFAM
Pfam:Esterase 81 222 4.8e-8 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000113585
AA Change: V23A

PolyPhen 2 Score 0.769 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000109215
Gene: ENSMUSG00000033174
AA Change: V23A

DomainStartEndE-ValueType
Pfam:Hydrolase_4 27 105 6e-29 PFAM
Pfam:Abhydrolase_5 43 270 1e-21 PFAM
Pfam:Abhydrolase_6 44 282 4.4e-26 PFAM
Pfam:DUF2305 55 186 1.7e-7 PFAM
Pfam:Lipase_3 56 163 1.6e-9 PFAM
Pfam:Abhydrolase_1 71 284 4.2e-14 PFAM
Pfam:Esterase 82 195 8.6e-8 PFAM
Pfam:Abhydrolase_3 88 273 8.8e-7 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000150180
AA Change: V23A

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000145068
Gene: ENSMUSG00000033174
AA Change: V23A

DomainStartEndE-ValueType
Pfam:Hydrolase_4 39 78 3.1e-10 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000163271
AA Change: V39A

PolyPhen 2 Score 0.736 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000127374
Gene: ENSMUSG00000033174
AA Change: V39A

DomainStartEndE-ValueType
Pfam:Hydrolase_4 43 121 3e-28 PFAM
Pfam:Abhydrolase_5 59 286 3.9e-21 PFAM
Pfam:Abhydrolase_6 60 298 1.1e-25 PFAM
Pfam:DUF2305 71 202 1.3e-7 PFAM
Pfam:Lipase_3 72 179 2.6e-9 PFAM
Pfam:Abhydrolase_1 87 300 1.1e-13 PFAM
Pfam:Esterase 98 211 2e-7 PFAM
Pfam:Abhydrolase_3 104 289 8.7e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000203608
AA Change: V23A

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000203824
AA Change: V23A

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 96% (55/57)
MGI Phenotype FUNCTION: This gene encodes a monoglyceride lipase, which catalyzes the hydrolysis of monoglycerides into fatty acids and glycerol. This enzyme is also thought to hydrolyze the endocannabinoid 2-arachidonoylglycerol. Alternatively spliced transcript variants have been described. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit hypoalgesia, increased body temperature, and decreased fatty acid levels. Mice homozygous for a targeted allele exhibit impaired lipolysis and improved glucose homeostasis on a high-fat diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadac A C 3: 60,038,472 S188R probably damaging Het
Aars T A 8: 111,041,657 I220N probably damaging Het
Abca15 A G 7: 120,332,217 N16S probably damaging Het
Adck1 A T 12: 88,456,800 M358L probably benign Het
Adck5 A T 15: 76,594,548 Q345L probably benign Het
Adgrl2 A G 3: 148,836,458 F876S probably damaging Het
Aebp2 T A 6: 140,623,858 L55Q unknown Het
Ampd2 C A 3: 108,080,116 V134L probably benign Het
Aox3 T C 1: 58,176,517 V1036A possibly damaging Het
Aox4 A G 1: 58,240,707 D494G probably benign Het
Cacna1a C A 8: 84,559,394 H889Q probably benign Het
Cacna1c T C 6: 119,052,626 D151G Het
Car8 A G 4: 8,237,939 V92A possibly damaging Het
Ccdc8 G T 7: 16,995,689 A368S unknown Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Cfap57 C T 4: 118,614,931 V84I probably benign Het
Cntnap5a A G 1: 116,442,283 I877V probably benign Het
Copa A T 1: 172,111,942 D582V probably damaging Het
Cpne2 T G 8: 94,568,684 S466A probably damaging Het
Crybg2 A G 4: 134,088,845 K1311R possibly damaging Het
Csmd1 A G 8: 15,932,461 probably null Het
Dnah2 A T 11: 69,451,318 C2947* probably null Het
Exoc1 A T 5: 76,561,512 K656* probably null Het
Exoc8 T C 8: 124,895,819 N603S probably benign Het
Fam171a1 T A 2: 3,225,446 C539S possibly damaging Het
Fastkd5 A T 2: 130,615,068 I534K probably damaging Het
Fbn1 T C 2: 125,303,195 D2708G probably benign Het
Fhad1 A G 4: 141,890,939 L1392P probably benign Het
Fras1 A T 5: 96,726,895 T2306S probably benign Het
Gdf7 G T 12: 8,301,854 A27E unknown Het
Hnrnph1 A T 11: 50,379,497 I43F probably damaging Het
Igkv8-27 T A 6: 70,172,015 S52C probably benign Het
Jmjd1c T C 10: 67,217,045 F24L probably damaging Het
Knl1 T G 2: 119,071,556 L1246R probably benign Het
Limk2 C T 11: 3,355,896 S191N probably damaging Het
Mdga2 G A 12: 66,689,350 A368V probably damaging Het
Mdga2 C A 12: 66,689,351 A368S possibly damaging Het
Med24 A T 11: 98,704,967 L966Q probably damaging Het
Nedd1 C T 10: 92,714,172 D84N probably benign Het
Obscn A C 11: 59,060,855 L4024R probably damaging Het
Olfr172 A T 16: 58,760,419 Y252* probably null Het
Pcnx2 T C 8: 125,851,107 I944V probably benign Het
Pecr T C 1: 72,266,998 probably null Het
Phf3 A T 1: 30,804,224 W1885R probably damaging Het
Pitpnm2 C G 5: 124,128,705 A697P probably benign Het
Piwil2 T A 14: 70,394,189 H602L probably benign Het
Pprc1 T C 19: 46,065,342 S1104P unknown Het
Prkar1a T A 11: 109,653,847 Y21* probably null Het
Prl2c3 A T 13: 12,798,297 Y9* probably null Het
Rhbdl3 T A 11: 80,323,579 L172Q possibly damaging Het
Rsph3a T G 17: 7,979,243 L484W probably damaging Het
Sbno1 A T 5: 124,392,899 S809T probably benign Het
Stmnd1 T A 13: 46,299,601 V251E possibly damaging Het
Stt3a A T 9: 36,751,239 C241* probably null Het
Tas2r114 A T 6: 131,689,438 M209K probably damaging Het
Tchh G T 3: 93,444,777 R508L unknown Het
Tgfbr3l T C 8: 4,250,622 S267P possibly damaging Het
Ttn T A 2: 76,767,800 I19590F probably damaging Het
Vmn1r171 A G 7: 23,632,610 T87A probably benign Het
Other mutations in Mgll
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03182:Mgll APN 6 88823191 missense probably damaging 1.00
PIT4677001:Mgll UTSW 6 88825681 missense possibly damaging 0.96
R0624:Mgll UTSW 6 88725817 missense probably damaging 0.98
R1550:Mgll UTSW 6 88813889 missense probably benign 0.00
R1779:Mgll UTSW 6 88813948 nonsense probably null
R2230:Mgll UTSW 6 88825732 missense possibly damaging 0.65
R3712:Mgll UTSW 6 88764588 intron probably benign
R4751:Mgll UTSW 6 88725111 utr 5 prime probably benign
R5030:Mgll UTSW 6 88818665 critical splice donor site probably null
R5216:Mgll UTSW 6 88766329 nonsense probably null
R5523:Mgll UTSW 6 88725761 missense probably benign 0.04
R6545:Mgll UTSW 6 88825703 missense probably benign
R7251:Mgll UTSW 6 88823375 missense probably benign 0.17
R7307:Mgll UTSW 6 88814121 splice site probably null
R8269:Mgll UTSW 6 88813948 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTGCCTAGAAAAGAAGCCACAG -3'
(R):5'- GAACTCTTGAGCCGTCATTTTAAAG -3'

Sequencing Primer
(F):5'- GCCACAGCCACAGTCCTG -3'
(R):5'- TGCTAACACCGCTGTGC -3'
Posted On2019-11-26