Incidental Mutation 'R0632:Dst'
ID 59679
Institutional Source Beutler Lab
Gene Symbol Dst
Ensembl Gene ENSMUSG00000026131
Gene Name dystonin
Synonyms bullous pemphigoid antigen 1, BPAG1-n, Macf2, bullous pemphigoid antigen 1, Bpag1, A830042E19Rik, 2310001O04Rik, athetoid, Bpag, BPAG1, nmf203, nmf339, ah
MMRRC Submission 038821-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.338) question?
Stock # R0632 (G1)
Quality Score 154
Status Validated
Chromosome 1
Chromosomal Location 33947306-34347742 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 34310494 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 4098 (R4098L)
Ref Sequence ENSEMBL: ENSMUSP00000141127 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097785] [ENSMUST00000097786] [ENSMUST00000115104] [ENSMUST00000182018] [ENSMUST00000183034] [ENSMUST00000185269] [ENSMUST00000194192]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000097785
AA Change: R6329L

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000095392
Gene: ENSMUSG00000026131
AA Change: R6329L

DomainStartEndE-ValueType
CH 37 136 1.62e-28 SMART
CH 153 250 3.72e-19 SMART
PDB:2ODU|A 261 479 1e-42 PDB
low complexity region 520 545 N/A INTRINSIC
SPEC 602 699 8.64e-9 SMART
SPEC 702 802 2.94e-11 SMART
Blast:SPEC 809 973 4e-73 BLAST
coiled coil region 1095 1132 N/A INTRINSIC
Blast:SPEC 1176 1285 6e-63 BLAST
SPEC 1292 1421 4.11e0 SMART
SPEC 1439 1538 4.66e0 SMART
PLEC 1537 1581 9.05e-3 SMART
PLEC 1582 1619 2.7e0 SMART
PLEC 1657 1694 2.23e0 SMART
PLEC 1695 1732 4.25e1 SMART
PLEC 1735 1770 1.39e2 SMART
PLEC 1771 1808 7.4e-8 SMART
PLEC 1811 1846 5.8e-1 SMART
PLEC 1847 1884 2.71e1 SMART
PLEC 1886 1922 4.66e0 SMART
low complexity region 2294 2307 N/A INTRINSIC
low complexity region 2366 2381 N/A INTRINSIC
low complexity region 2477 2491 N/A INTRINSIC
low complexity region 2566 2593 N/A INTRINSIC
low complexity region 2661 2675 N/A INTRINSIC
low complexity region 2793 2799 N/A INTRINSIC
low complexity region 2839 2847 N/A INTRINSIC
low complexity region 3046 3057 N/A INTRINSIC
low complexity region 3294 3314 N/A INTRINSIC
SPEC 3321 3427 5.36e-1 SMART
low complexity region 3515 3527 N/A INTRINSIC
low complexity region 3548 3558 N/A INTRINSIC
SPEC 3569 3678 2.19e-1 SMART
internal_repeat_7 3771 3811 5.09e-5 PROSPERO
SPEC 3852 3971 1.75e-9 SMART
SPEC 3978 4084 3.7e-8 SMART
SPEC 4091 4190 4.56e-8 SMART
SPEC 4200 4299 3.78e0 SMART
low complexity region 4372 4388 N/A INTRINSIC
SPEC 4447 4552 1.98e-8 SMART
SPEC 4559 4663 3.62e-11 SMART
SPEC 4673 4773 1.65e-5 SMART
SPEC 4780 4882 7.75e-11 SMART
SPEC 4889 4989 2.3e-4 SMART
SPEC 4999 5098 3.01e0 SMART
SPEC 5105 5208 2.74e-2 SMART
SPEC 5215 5319 2.46e-4 SMART
SPEC 5326 5428 1.27e-15 SMART
SPEC 5435 5537 1.54e-14 SMART
SPEC 5544 5646 8.07e-2 SMART
SPEC 5653 5755 3.67e-12 SMART
SPEC 5762 5863 1.97e-12 SMART
SPEC 5870 5976 4.19e-7 SMART
SPEC 5983 6085 2.06e-15 SMART
SPEC 6092 6195 2.89e-10 SMART
SPEC 6202 6304 2.61e-26 SMART
SPEC 6311 6413 5.31e-18 SMART
SPEC 6420 6522 1.25e-14 SMART
SPEC 6529 6632 9.1e-17 SMART
SPEC 6639 6740 9.3e-23 SMART
SPEC 6747 6849 5.43e-15 SMART
SPEC 6859 6989 1.5e-8 SMART
EFh 7023 7051 4.12e-3 SMART
EFh 7059 7087 1.25e-2 SMART
GAS2 7098 7176 3.08e-51 SMART
low complexity region 7224 7242 N/A INTRINSIC
low complexity region 7252 7264 N/A INTRINSIC
low complexity region 7313 7336 N/A INTRINSIC
PDB:3GJO|H 7364 7393 9e-10 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000097786
AA Change: R4315L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000095393
Gene: ENSMUSG00000026131
AA Change: R4315L

DomainStartEndE-ValueType
CH 37 136 1.62e-28 SMART
CH 153 250 3.72e-19 SMART
PDB:2ODU|A 261 479 6e-43 PDB
low complexity region 520 545 N/A INTRINSIC
SPEC 602 699 8.64e-9 SMART
SPEC 702 802 2.94e-11 SMART
Blast:SPEC 809 973 2e-73 BLAST
coiled coil region 1095 1132 N/A INTRINSIC
Blast:SPEC 1176 1285 2e-62 BLAST
SPEC 1292 1421 4.11e0 SMART
SPEC 1439 1538 4.66e0 SMART
SPEC 1555 1664 2.19e-1 SMART
internal_repeat_6 1757 1797 1.18e-5 PROSPERO
SPEC 1838 1957 1.75e-9 SMART
SPEC 1964 2070 3.7e-8 SMART
SPEC 2077 2176 4.56e-8 SMART
SPEC 2186 2285 3.78e0 SMART
low complexity region 2358 2374 N/A INTRINSIC
SPEC 2433 2538 1.98e-8 SMART
SPEC 2545 2649 3.62e-11 SMART
SPEC 2659 2759 1.65e-5 SMART
SPEC 2766 2868 7.75e-11 SMART
SPEC 2875 2975 2.3e-4 SMART
SPEC 2985 3084 3.01e0 SMART
SPEC 3091 3194 2.74e-2 SMART
SPEC 3201 3305 2.46e-4 SMART
SPEC 3312 3414 1.27e-15 SMART
SPEC 3421 3523 1.54e-14 SMART
SPEC 3530 3632 8.07e-2 SMART
SPEC 3639 3741 3.67e-12 SMART
SPEC 3748 3849 1.97e-12 SMART
SPEC 3856 3962 4.19e-7 SMART
SPEC 3969 4071 2.06e-15 SMART
SPEC 4078 4181 2.89e-10 SMART
SPEC 4188 4290 2.61e-26 SMART
SPEC 4297 4399 5.31e-18 SMART
SPEC 4406 4508 1.25e-14 SMART
SPEC 4515 4618 9.1e-17 SMART
SPEC 4625 4726 9.3e-23 SMART
SPEC 4733 4835 5.43e-15 SMART
SPEC 4845 4975 1.5e-8 SMART
EFh 5009 5037 4.12e-3 SMART
EFh 5045 5073 1.25e-2 SMART
GAS2 5084 5162 3.08e-51 SMART
low complexity region 5210 5228 N/A INTRINSIC
low complexity region 5238 5250 N/A INTRINSIC
low complexity region 5299 5322 N/A INTRINSIC
PDB:3GJO|H 5350 5379 1e-9 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000115104
AA Change: R6329L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110756
Gene: ENSMUSG00000026131
AA Change: R6329L

DomainStartEndE-ValueType
CH 37 136 1.62e-28 SMART
CH 153 250 3.72e-19 SMART
PDB:2ODU|A 261 479 1e-42 PDB
low complexity region 520 545 N/A INTRINSIC
SPEC 602 699 8.64e-9 SMART
SPEC 702 802 2.94e-11 SMART
Blast:SPEC 809 973 4e-73 BLAST
coiled coil region 1095 1132 N/A INTRINSIC
Blast:SPEC 1176 1285 6e-63 BLAST
SPEC 1292 1421 4.11e0 SMART
SPEC 1439 1538 4.66e0 SMART
PLEC 1537 1581 9.05e-3 SMART
PLEC 1582 1619 2.7e0 SMART
PLEC 1657 1694 2.23e0 SMART
PLEC 1695 1732 4.25e1 SMART
PLEC 1735 1770 1.39e2 SMART
PLEC 1771 1808 7.4e-8 SMART
PLEC 1811 1846 5.8e-1 SMART
PLEC 1847 1884 2.71e1 SMART
PLEC 1886 1922 4.66e0 SMART
low complexity region 2294 2307 N/A INTRINSIC
low complexity region 2366 2381 N/A INTRINSIC
low complexity region 2477 2491 N/A INTRINSIC
low complexity region 2566 2593 N/A INTRINSIC
low complexity region 2661 2675 N/A INTRINSIC
low complexity region 2793 2799 N/A INTRINSIC
low complexity region 2839 2847 N/A INTRINSIC
low complexity region 3046 3057 N/A INTRINSIC
low complexity region 3294 3314 N/A INTRINSIC
SPEC 3321 3427 5.36e-1 SMART
low complexity region 3515 3527 N/A INTRINSIC
low complexity region 3548 3558 N/A INTRINSIC
SPEC 3569 3678 2.19e-1 SMART
internal_repeat_7 3771 3811 5.08e-5 PROSPERO
SPEC 3852 3971 1.75e-9 SMART
SPEC 3978 4084 3.7e-8 SMART
SPEC 4091 4190 4.56e-8 SMART
SPEC 4200 4299 3.78e0 SMART
low complexity region 4372 4388 N/A INTRINSIC
SPEC 4447 4552 1.98e-8 SMART
SPEC 4559 4663 3.62e-11 SMART
SPEC 4673 4773 1.65e-5 SMART
SPEC 4780 4882 7.75e-11 SMART
SPEC 4889 4989 2.3e-4 SMART
SPEC 4999 5098 3.01e0 SMART
SPEC 5105 5208 2.74e-2 SMART
SPEC 5215 5319 2.46e-4 SMART
SPEC 5326 5428 1.27e-15 SMART
SPEC 5435 5537 1.54e-14 SMART
SPEC 5544 5646 8.07e-2 SMART
SPEC 5653 5755 3.67e-12 SMART
SPEC 5762 5863 1.97e-12 SMART
SPEC 5870 5976 4.19e-7 SMART
SPEC 5983 6085 2.06e-15 SMART
SPEC 6092 6195 2.89e-10 SMART
SPEC 6202 6304 2.61e-26 SMART
SPEC 6311 6413 5.31e-18 SMART
SPEC 6420 6522 1.25e-14 SMART
SPEC 6529 6632 9.1e-17 SMART
SPEC 6639 6740 9.3e-23 SMART
SPEC 6747 6849 5.43e-15 SMART
SPEC 6859 6989 1.5e-8 SMART
EFh 7023 7051 4.12e-3 SMART
EFh 7059 7087 1.25e-2 SMART
GAS2 7098 7176 3.85e-52 SMART
low complexity region 7200 7218 N/A INTRINSIC
low complexity region 7228 7240 N/A INTRINSIC
low complexity region 7326 7349 N/A INTRINSIC
PDB:3GJO|H 7377 7406 9e-10 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000182018
AA Change: R561L

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000138426
Gene: ENSMUSG00000026131
AA Change: R561L

DomainStartEndE-ValueType
SPEC 1 95 3.1e-8 SMART
SPEC 102 208 2.6e-9 SMART
SPEC 215 317 1.3e-17 SMART
SPEC 324 427 1.8e-12 SMART
SPEC 434 536 1.6e-28 SMART
SPEC 543 645 3.3e-20 SMART
SPEC 652 754 7.6e-17 SMART
SPEC 761 864 5.6e-19 SMART
SPEC 871 972 5.9e-25 SMART
SPEC 979 1081 3.4e-17 SMART
SPEC 1091 1221 9.7e-11 SMART
EFh 1255 1283 2e-5 SMART
EFh 1291 1319 6e-5 SMART
GAS2 1330 1408 9.8e-56 SMART
low complexity region 1432 1450 N/A INTRINSIC
low complexity region 1460 1472 N/A INTRINSIC
low complexity region 1558 1581 N/A INTRINSIC
PDB:3GJO|H 1609 1638 2e-10 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000183034
AA Change: R6616L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000138308
Gene: ENSMUSG00000026131
AA Change: R6616L

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
low complexity region 82 92 N/A INTRINSIC
low complexity region 149 163 N/A INTRINSIC
CH 215 314 1.62e-28 SMART
CH 331 428 3.72e-19 SMART
PDB:2ODU|A 439 657 1e-42 PDB
low complexity region 698 723 N/A INTRINSIC
SPEC 780 877 8.64e-9 SMART
SPEC 880 980 2.94e-11 SMART
Blast:SPEC 987 1151 5e-73 BLAST
coiled coil region 1273 1310 N/A INTRINSIC
Blast:SPEC 1354 1463 8e-63 BLAST
SPEC 1470 1599 4.11e0 SMART
SPEC 1617 1716 4.66e0 SMART
PLEC 1715 1759 9.05e-3 SMART
PLEC 1760 1797 2.7e0 SMART
PLEC 1835 1872 2.23e0 SMART
PLEC 1873 1910 4.25e1 SMART
PLEC 1913 1948 1.39e2 SMART
PLEC 1949 1986 7.4e-8 SMART
PLEC 1989 2024 5.8e-1 SMART
PLEC 2025 2062 2.71e1 SMART
PLEC 2064 2100 4.66e0 SMART
low complexity region 2472 2485 N/A INTRINSIC
low complexity region 2544 2559 N/A INTRINSIC
low complexity region 2655 2669 N/A INTRINSIC
low complexity region 2744 2771 N/A INTRINSIC
low complexity region 2839 2853 N/A INTRINSIC
low complexity region 2971 2977 N/A INTRINSIC
low complexity region 3017 3025 N/A INTRINSIC
low complexity region 3224 3235 N/A INTRINSIC
low complexity region 3472 3492 N/A INTRINSIC
SPEC 3499 3605 5.36e-1 SMART
low complexity region 3693 3705 N/A INTRINSIC
low complexity region 3726 3736 N/A INTRINSIC
SPEC 3747 3856 2.19e-1 SMART
internal_repeat_12 3949 3989 5.99e-5 PROSPERO
SPEC 4030 4149 1.75e-9 SMART
SPEC 4156 4262 3.7e-8 SMART
SPEC 4269 4368 4.56e-8 SMART
SPEC 4378 4477 3.78e0 SMART
low complexity region 4550 4566 N/A INTRINSIC
SPEC 4625 4730 1.98e-8 SMART
SPEC 4737 4841 3.62e-11 SMART
SPEC 4851 4951 1.65e-5 SMART
SPEC 4958 5060 7.75e-11 SMART
SPEC 5067 5167 2.3e-4 SMART
SPEC 5177 5276 3.01e0 SMART
SPEC 5283 5386 2.74e-2 SMART
SPEC 5393 5497 2.46e-4 SMART
SPEC 5504 5606 1.27e-15 SMART
SPEC 5613 5715 1.69e-11 SMART
SPEC 5722 5824 9.33e-5 SMART
SPEC 5831 5933 8.07e-2 SMART
SPEC 5940 6042 3.67e-12 SMART
SPEC 6049 6150 1.97e-12 SMART
SPEC 6157 6263 4.19e-7 SMART
SPEC 6270 6372 2.06e-15 SMART
SPEC 6379 6482 2.89e-10 SMART
SPEC 6489 6591 2.61e-26 SMART
SPEC 6598 6700 5.31e-18 SMART
SPEC 6707 6809 1.25e-14 SMART
SPEC 6816 6919 9.1e-17 SMART
SPEC 6926 7027 9.3e-23 SMART
SPEC 7034 7136 5.43e-15 SMART
SPEC 7146 7276 1.5e-8 SMART
EFh 7310 7338 4.12e-3 SMART
EFh 7346 7374 1.25e-2 SMART
GAS2 7385 7463 3.08e-51 SMART
low complexity region 7511 7529 N/A INTRINSIC
low complexity region 7539 7551 N/A INTRINSIC
low complexity region 7637 7660 N/A INTRINSIC
PDB:3GJO|H 7688 7717 9e-10 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000185269
AA Change: R4098L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141127
Gene: ENSMUSG00000026131
AA Change: R4098L

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
PDB:2ODU|A 56 153 6e-8 PDB
low complexity region 194 219 N/A INTRINSIC
SPEC 276 373 5.4e-11 SMART
SPEC 376 476 1.8e-13 SMART
Blast:SPEC 483 647 1e-73 BLAST
coiled coil region 769 806 N/A INTRINSIC
Blast:SPEC 850 959 1e-62 BLAST
SPEC 966 1095 2.6e-2 SMART
SPEC 1113 1212 2.9e-2 SMART
SPEC 1229 1338 1.4e-3 SMART
internal_repeat_10 1431 1471 9.93e-6 PROSPERO
SPEC 1512 1631 1.1e-11 SMART
SPEC 1638 1744 2.3e-10 SMART
SPEC 1751 1850 2.9e-10 SMART
SPEC 1860 1959 2.4e-2 SMART
low complexity region 2032 2048 N/A INTRINSIC
SPEC 2107 2212 1.2e-10 SMART
SPEC 2219 2323 2.3e-13 SMART
SPEC 2333 2433 1.1e-7 SMART
SPEC 2440 2542 5e-13 SMART
SPEC 2549 2649 1.4e-6 SMART
SPEC 2659 2758 1.9e-2 SMART
SPEC 2765 2868 1.8e-4 SMART
SPEC 2875 2979 1.5e-6 SMART
SPEC 2986 3088 8.2e-18 SMART
SPEC 3095 3197 1.1e-13 SMART
SPEC 3204 3306 6e-7 SMART
SPEC 3313 3415 5.1e-4 SMART
SPEC 3422 3524 2.3e-14 SMART
SPEC 3531 3632 1.3e-14 SMART
SPEC 3639 3745 2.6e-9 SMART
SPEC 3752 3854 1.3e-17 SMART
SPEC 3861 3964 1.8e-12 SMART
SPEC 3971 4073 1.6e-28 SMART
SPEC 4080 4182 3.3e-20 SMART
SPEC 4189 4291 7.6e-17 SMART
SPEC 4298 4401 5.6e-19 SMART
SPEC 4408 4509 5.9e-25 SMART
SPEC 4516 4618 3.4e-17 SMART
SPEC 4628 4758 9.7e-11 SMART
EFh 4792 4820 2e-5 SMART
EFh 4828 4856 6e-5 SMART
GAS2 4867 4945 9.8e-56 SMART
low complexity region 4969 4987 N/A INTRINSIC
low complexity region 4997 5009 N/A INTRINSIC
low complexity region 5095 5118 N/A INTRINSIC
PDB:3GJO|H 5146 5175 3e-9 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000194192
AA Change: R1613L

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194920
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185736
Meta Mutation Damage Score 0.2788 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.0%
Validation Efficiency 95% (81/85)
MGI Phenotype PHENOTYPE: Mutations in this gene produce peripheral nervous system demyelination resulting in impaired muscle function and shorter lifespan. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaa1a T A 9: 119,176,884 (GRCm39) probably benign Het
Adgrg7 T A 16: 56,562,952 (GRCm39) T462S possibly damaging Het
Akap6 A T 12: 52,983,931 (GRCm39) N825I probably damaging Het
Ankib1 T A 5: 3,822,529 (GRCm39) N59I probably benign Het
Anks6 T C 4: 47,033,167 (GRCm39) S633G possibly damaging Het
Ap4e1 C A 2: 126,891,200 (GRCm39) Y522* probably null Het
Art5 G A 7: 101,747,164 (GRCm39) T205I probably damaging Het
Ascc2 T A 11: 4,599,855 (GRCm39) L176H probably damaging Het
Atp13a5 T C 16: 29,117,026 (GRCm39) D529G probably benign Het
C2cd4a T C 9: 67,738,845 (GRCm39) E66G probably benign Het
C8a T C 4: 104,713,689 (GRCm39) D147G probably damaging Het
Ccdc14 T C 16: 34,542,019 (GRCm39) V532A possibly damaging Het
Ccdc88a T A 11: 29,432,749 (GRCm39) probably benign Het
Cfap54 C T 10: 92,720,958 (GRCm39) E2543K unknown Het
Cldn13 C T 5: 134,943,601 (GRCm39) E195K probably benign Het
Cp A G 3: 20,025,246 (GRCm39) S402G probably null Het
Cpa3 T C 3: 20,279,358 (GRCm39) T194A probably benign Het
Crygf C A 1: 65,967,156 (GRCm39) Y93* probably null Het
Ctsh A G 9: 89,943,635 (GRCm39) R87G possibly damaging Het
Cyp2t4 A G 7: 26,857,671 (GRCm39) D428G possibly damaging Het
Dnah17 C G 11: 117,958,508 (GRCm39) probably benign Het
Dnah3 A G 7: 119,567,128 (GRCm39) V2366A probably benign Het
Dscaml1 A T 9: 45,643,432 (GRCm39) I1284F probably benign Het
Dsg1c T C 18: 20,405,403 (GRCm39) probably benign Het
Efhb A G 17: 53,720,487 (GRCm39) probably benign Het
Epha7 A T 4: 28,821,104 (GRCm39) I90F probably damaging Het
Fam171a2 T A 11: 102,328,707 (GRCm39) D684V probably damaging Het
Fan1 A G 7: 64,012,947 (GRCm39) V665A possibly damaging Het
Fbn2 A G 18: 58,170,819 (GRCm39) C2191R probably damaging Het
Fkbp3 G A 12: 65,120,692 (GRCm39) A2V probably benign Het
G6pd2 A G 5: 61,967,514 (GRCm39) N430D probably benign Het
Gm13547 T A 2: 29,651,596 (GRCm39) D7E possibly damaging Het
H4c9 G T 13: 22,225,197 (GRCm39) Y99* probably null Het
Hdac5 A T 11: 102,096,638 (GRCm39) D260E probably damaging Het
Hsf2bp T C 17: 32,232,320 (GRCm39) E142G probably damaging Het
Igf1r C T 7: 67,814,903 (GRCm39) T268I probably damaging Het
Inava T C 1: 136,155,356 (GRCm39) D83G probably benign Het
Kcne3 C T 7: 99,833,646 (GRCm39) R88C probably damaging Het
Klk1b9 G T 7: 43,628,796 (GRCm39) G100V possibly damaging Het
Kmt2d G A 15: 98,751,462 (GRCm39) probably benign Het
Lama1 C T 17: 68,059,363 (GRCm39) probably benign Het
Lcp2 C T 11: 34,032,426 (GRCm39) P335S possibly damaging Het
Lrrk2 T A 15: 91,680,231 (GRCm39) N2047K probably damaging Het
Mcub T C 3: 129,712,375 (GRCm39) M167V probably benign Het
Mia2 T C 12: 59,182,929 (GRCm39) L36P probably damaging Het
Mmp13 G A 9: 7,274,032 (GRCm39) G169R probably damaging Het
Mmp13 A T 9: 7,282,077 (GRCm39) I460F possibly damaging Het
Msh4 A G 3: 153,602,532 (GRCm39) I232T probably damaging Het
Msra T A 14: 64,447,981 (GRCm39) M145L probably benign Het
Myo7a A T 7: 97,761,357 (GRCm39) probably benign Het
Nme8 A T 13: 19,842,206 (GRCm39) N422K probably damaging Het
Nol6 A T 4: 41,121,115 (GRCm39) F353I probably damaging Het
Nphp3 A G 9: 103,895,473 (GRCm39) K384E probably damaging Het
Or51h5 C T 7: 102,577,811 (GRCm39) probably null Het
Or52e15 A G 7: 104,645,910 (GRCm39) I67T probably benign Het
Or52h7 A G 7: 104,213,544 (GRCm39) I39V probably benign Het
Phox2b T G 5: 67,253,557 (GRCm39) probably benign Het
Plec A T 15: 76,057,611 (GRCm39) S4131T probably damaging Het
Pptc7 G A 5: 122,451,654 (GRCm39) probably benign Het
Pramel31 G A 4: 144,090,352 (GRCm39) C464Y probably damaging Het
Prpf40b A G 15: 99,214,170 (GRCm39) E810G probably benign Het
Ptprc C T 1: 138,001,348 (GRCm39) V965I probably benign Het
Pum1 T A 4: 130,455,415 (GRCm39) M180K probably benign Het
Ranbp3 T C 17: 57,009,896 (GRCm39) probably benign Het
Rasgrf2 A G 13: 92,120,393 (GRCm39) S787P probably benign Het
Rnf19b T A 4: 128,967,344 (GRCm39) N294K probably damaging Het
Samd3 A T 10: 26,120,393 (GRCm39) H156L possibly damaging Het
Serpinb6c C T 13: 34,064,014 (GRCm39) R347Q possibly damaging Het
Slc36a3 A G 11: 55,015,906 (GRCm39) I416T probably damaging Het
Slc4a4 T A 5: 89,277,500 (GRCm39) F279Y probably damaging Het
Slc6a2 T A 8: 93,719,429 (GRCm39) probably benign Het
Snrnp40 C G 4: 130,271,836 (GRCm39) probably null Het
Tab2 A G 10: 7,795,565 (GRCm39) S232P probably benign Het
Tacc2 A T 7: 130,227,325 (GRCm39) K1356* probably null Het
Tmem87a A G 2: 120,190,023 (GRCm39) S544P probably damaging Het
Trim52 T A 14: 106,344,401 (GRCm39) C20S probably damaging Het
Usp38 A T 8: 81,740,779 (GRCm39) V96E probably benign Het
Vmn2r59 T C 7: 41,708,308 (GRCm39) Y33C probably damaging Het
Vsig10l T G 7: 43,113,561 (GRCm39) V171G probably damaging Het
Zfp957 T A 14: 79,450,360 (GRCm39) I480F probably damaging Het
Other mutations in Dst
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Dst APN 1 34,290,920 (GRCm39) missense probably damaging 1.00
IGL00309:Dst APN 1 34,199,733 (GRCm39) missense probably damaging 1.00
IGL00334:Dst APN 1 34,205,373 (GRCm39) missense probably damaging 1.00
IGL00470:Dst APN 1 34,228,043 (GRCm39) missense probably damaging 1.00
IGL00481:Dst APN 1 34,208,410 (GRCm39) splice site probably benign
IGL00499:Dst APN 1 34,329,504 (GRCm39) missense probably damaging 0.99
IGL00803:Dst APN 1 34,203,205 (GRCm39) missense possibly damaging 0.89
IGL00850:Dst APN 1 34,345,705 (GRCm39) missense probably damaging 1.00
IGL00957:Dst APN 1 34,267,488 (GRCm39) missense probably benign 0.27
IGL00975:Dst APN 1 34,227,393 (GRCm39) missense possibly damaging 0.86
IGL00984:Dst APN 1 34,295,401 (GRCm39) missense probably damaging 1.00
IGL01284:Dst APN 1 34,203,009 (GRCm39) missense probably damaging 1.00
IGL01393:Dst APN 1 34,206,706 (GRCm39) missense possibly damaging 0.91
IGL01397:Dst APN 1 34,296,825 (GRCm39) missense probably damaging 1.00
IGL01399:Dst APN 1 34,156,598 (GRCm39) missense probably benign 0.41
IGL01412:Dst APN 1 34,281,701 (GRCm39) missense probably benign 0.21
IGL01527:Dst APN 1 34,286,734 (GRCm39) missense probably damaging 1.00
IGL01537:Dst APN 1 34,314,401 (GRCm39) missense probably damaging 1.00
IGL01618:Dst APN 1 34,227,990 (GRCm39) nonsense probably null
IGL01636:Dst APN 1 34,254,650 (GRCm39) missense probably damaging 1.00
IGL01642:Dst APN 1 34,228,470 (GRCm39) missense probably damaging 1.00
IGL01672:Dst APN 1 34,264,774 (GRCm39) missense probably damaging 1.00
IGL01685:Dst APN 1 34,209,533 (GRCm39) missense probably damaging 0.99
IGL01694:Dst APN 1 34,227,241 (GRCm39) missense probably benign 0.13
IGL01777:Dst APN 1 34,238,478 (GRCm39) missense probably benign 0.07
IGL01800:Dst APN 1 34,301,173 (GRCm39) missense probably damaging 1.00
IGL01811:Dst APN 1 34,203,173 (GRCm39) missense probably damaging 1.00
IGL01960:Dst APN 1 34,329,570 (GRCm39) missense probably damaging 1.00
IGL02031:Dst APN 1 34,228,998 (GRCm39) missense possibly damaging 0.95
IGL02103:Dst APN 1 34,229,199 (GRCm39) missense possibly damaging 0.90
IGL02121:Dst APN 1 34,267,738 (GRCm39) missense probably damaging 1.00
IGL02315:Dst APN 1 34,237,746 (GRCm39) missense probably damaging 1.00
IGL02317:Dst APN 1 34,334,244 (GRCm39) missense probably damaging 1.00
IGL02469:Dst APN 1 34,227,909 (GRCm39) missense probably damaging 1.00
IGL02492:Dst APN 1 34,191,274 (GRCm39) splice site probably benign
IGL02510:Dst APN 1 34,268,332 (GRCm39) splice site probably null
IGL02522:Dst APN 1 34,289,781 (GRCm39) splice site probably benign
IGL02540:Dst APN 1 34,174,285 (GRCm39) missense probably damaging 1.00
IGL02588:Dst APN 1 34,156,565 (GRCm39) missense probably damaging 1.00
IGL02676:Dst APN 1 34,346,668 (GRCm39) missense probably damaging 1.00
IGL02688:Dst APN 1 34,235,033 (GRCm39) missense probably damaging 1.00
IGL02700:Dst APN 1 34,301,201 (GRCm39) missense probably damaging 1.00
IGL02794:Dst APN 1 34,309,910 (GRCm39) missense probably damaging 1.00
IGL02823:Dst APN 1 34,231,164 (GRCm39) missense possibly damaging 0.83
IGL02935:Dst APN 1 34,225,926 (GRCm39) nonsense probably null
IGL02940:Dst APN 1 34,328,668 (GRCm39) missense probably benign 0.36
IGL02994:Dst APN 1 34,268,333 (GRCm39) splice site probably benign
IGL02996:Dst APN 1 34,227,479 (GRCm39) missense possibly damaging 0.93
IGL02998:Dst APN 1 34,307,356 (GRCm39) missense probably damaging 1.00
IGL03027:Dst APN 1 34,225,106 (GRCm39) missense possibly damaging 0.51
IGL03033:Dst APN 1 34,208,826 (GRCm39) splice site probably benign
IGL03099:Dst APN 1 34,314,862 (GRCm39) missense probably damaging 1.00
IGL03119:Dst APN 1 34,200,143 (GRCm39) missense probably damaging 1.00
IGL03121:Dst APN 1 34,256,884 (GRCm39) splice site probably benign
IGL03132:Dst APN 1 34,295,722 (GRCm39) missense probably benign 0.06
IGL03220:Dst APN 1 34,225,076 (GRCm39) missense probably damaging 0.99
IGL03230:Dst APN 1 34,223,133 (GRCm39) nonsense probably null
IGL03245:Dst APN 1 34,250,229 (GRCm39) splice site probably null
IGL03380:Dst APN 1 34,296,881 (GRCm39) missense probably damaging 1.00
Doodle UTSW 1 34,247,639 (GRCm39) nonsense probably null
dyssed UTSW 1 34,295,434 (GRCm39) critical splice donor site probably null
gobble UTSW 1 34,204,236 (GRCm39) critical splice donor site probably null
Phelps UTSW 1 34,262,876 (GRCm39) splice site probably null
tinsel UTSW 1 34,203,248 (GRCm39) missense probably damaging 1.00
Wastable UTSW 1 34,334,370 (GRCm39) missense probably damaging 1.00
E0370:Dst UTSW 1 34,288,552 (GRCm39) splice site probably benign
FR4304:Dst UTSW 1 34,240,045 (GRCm39) missense probably damaging 0.99
G1citation:Dst UTSW 1 34,314,755 (GRCm39) missense probably damaging 0.99
IGL02799:Dst UTSW 1 34,218,930 (GRCm39) missense possibly damaging 0.92
R0006:Dst UTSW 1 34,267,999 (GRCm39) missense probably benign 0.30
R0006:Dst UTSW 1 34,267,999 (GRCm39) missense probably benign 0.30
R0023:Dst UTSW 1 34,228,200 (GRCm39) missense probably damaging 1.00
R0023:Dst UTSW 1 34,228,200 (GRCm39) missense probably damaging 1.00
R0024:Dst UTSW 1 34,228,200 (GRCm39) missense probably damaging 1.00
R0027:Dst UTSW 1 34,228,200 (GRCm39) missense probably damaging 1.00
R0049:Dst UTSW 1 34,314,862 (GRCm39) missense probably damaging 1.00
R0053:Dst UTSW 1 34,333,631 (GRCm39) splice site probably null
R0053:Dst UTSW 1 34,333,631 (GRCm39) splice site probably null
R0058:Dst UTSW 1 34,045,305 (GRCm39) missense possibly damaging 0.93
R0066:Dst UTSW 1 34,228,634 (GRCm39) missense possibly damaging 0.67
R0066:Dst UTSW 1 34,228,634 (GRCm39) missense possibly damaging 0.67
R0085:Dst UTSW 1 34,268,268 (GRCm39) missense probably damaging 1.00
R0125:Dst UTSW 1 34,309,984 (GRCm39) missense probably damaging 1.00
R0152:Dst UTSW 1 34,228,200 (GRCm39) missense probably damaging 1.00
R0165:Dst UTSW 1 34,193,727 (GRCm39) splice site probably benign
R0172:Dst UTSW 1 34,309,935 (GRCm39) missense probably damaging 1.00
R0207:Dst UTSW 1 34,226,016 (GRCm39) missense probably benign 0.02
R0219:Dst UTSW 1 34,342,559 (GRCm39) missense probably damaging 0.99
R0349:Dst UTSW 1 34,238,634 (GRCm39) missense probably benign 0.12
R0386:Dst UTSW 1 34,256,917 (GRCm39) missense probably damaging 1.00
R0389:Dst UTSW 1 34,333,631 (GRCm39) splice site probably null
R0395:Dst UTSW 1 34,228,200 (GRCm39) missense probably damaging 1.00
R0423:Dst UTSW 1 34,317,116 (GRCm39) missense possibly damaging 0.95
R0443:Dst UTSW 1 34,333,631 (GRCm39) splice site probably null
R0472:Dst UTSW 1 34,306,041 (GRCm39) critical splice donor site probably null
R0490:Dst UTSW 1 34,346,449 (GRCm39) nonsense probably null
R0513:Dst UTSW 1 34,258,612 (GRCm39) splice site probably benign
R0539:Dst UTSW 1 34,228,200 (GRCm39) missense probably damaging 1.00
R0562:Dst UTSW 1 34,267,062 (GRCm39) missense probably damaging 1.00
R0569:Dst UTSW 1 34,332,508 (GRCm39) missense probably damaging 1.00
R0600:Dst UTSW 1 34,228,200 (GRCm39) missense probably damaging 1.00
R0608:Dst UTSW 1 34,329,437 (GRCm39) splice site probably null
R0609:Dst UTSW 1 34,306,041 (GRCm39) critical splice donor site probably null
R0630:Dst UTSW 1 34,238,554 (GRCm39) missense probably damaging 0.98
R0630:Dst UTSW 1 34,232,531 (GRCm39) missense probably benign 0.05
R0713:Dst UTSW 1 34,228,200 (GRCm39) missense probably damaging 1.00
R0724:Dst UTSW 1 34,227,758 (GRCm39) missense probably benign 0.00
R0761:Dst UTSW 1 34,221,848 (GRCm39) missense probably benign 0.33
R0801:Dst UTSW 1 34,209,470 (GRCm39) missense probably damaging 0.99
R0829:Dst UTSW 1 34,202,301 (GRCm39) missense probably damaging 1.00
R0939:Dst UTSW 1 34,283,464 (GRCm39) missense probably damaging 1.00
R0945:Dst UTSW 1 34,310,500 (GRCm39) missense probably damaging 1.00
R0992:Dst UTSW 1 34,238,617 (GRCm39) missense probably damaging 0.97
R1018:Dst UTSW 1 34,233,174 (GRCm39) missense probably damaging 1.00
R1077:Dst UTSW 1 34,203,248 (GRCm39) missense probably damaging 1.00
R1079:Dst UTSW 1 34,225,944 (GRCm39) missense possibly damaging 0.86
R1127:Dst UTSW 1 34,314,358 (GRCm39) missense probably damaging 1.00
R1129:Dst UTSW 1 34,238,635 (GRCm39) missense probably benign 0.28
R1141:Dst UTSW 1 34,227,777 (GRCm39) missense possibly damaging 0.85
R1167:Dst UTSW 1 34,262,939 (GRCm39) missense probably damaging 1.00
R1195:Dst UTSW 1 34,250,235 (GRCm39) missense probably damaging 1.00
R1195:Dst UTSW 1 34,250,235 (GRCm39) missense probably damaging 1.00
R1195:Dst UTSW 1 34,250,235 (GRCm39) missense probably damaging 1.00
R1333:Dst UTSW 1 34,267,428 (GRCm39) missense probably damaging 1.00
R1352:Dst UTSW 1 34,268,329 (GRCm39) critical splice donor site probably null
R1365:Dst UTSW 1 34,227,275 (GRCm39) missense probably benign 0.02
R1382:Dst UTSW 1 34,307,914 (GRCm39) missense probably damaging 0.99
R1389:Dst UTSW 1 34,250,313 (GRCm39) missense probably damaging 1.00
R1394:Dst UTSW 1 34,204,236 (GRCm39) critical splice donor site probably null
R1395:Dst UTSW 1 34,204,236 (GRCm39) critical splice donor site probably null
R1435:Dst UTSW 1 34,153,026 (GRCm39) missense probably damaging 1.00
R1450:Dst UTSW 1 34,251,340 (GRCm39) missense probably damaging 0.99
R1450:Dst UTSW 1 34,227,476 (GRCm39) missense probably damaging 1.00
R1453:Dst UTSW 1 34,228,527 (GRCm39) missense possibly damaging 0.85
R1479:Dst UTSW 1 34,303,596 (GRCm39) splice site probably null
R1483:Dst UTSW 1 34,292,079 (GRCm39) missense probably damaging 1.00
R1491:Dst UTSW 1 34,193,675 (GRCm39) missense probably damaging 0.99
R1536:Dst UTSW 1 34,299,453 (GRCm39) splice site probably benign
R1551:Dst UTSW 1 34,231,293 (GRCm39) missense probably benign 0.01
R1573:Dst UTSW 1 34,240,312 (GRCm39) missense probably damaging 1.00
R1614:Dst UTSW 1 34,314,344 (GRCm39) missense probably damaging 1.00
R1615:Dst UTSW 1 34,238,452 (GRCm39) missense probably damaging 1.00
R1645:Dst UTSW 1 34,264,803 (GRCm39) missense probably damaging 1.00
R1655:Dst UTSW 1 34,321,657 (GRCm39) nonsense probably null
R1663:Dst UTSW 1 34,202,466 (GRCm39) missense probably damaging 1.00
R1674:Dst UTSW 1 34,262,876 (GRCm39) splice site probably null
R1702:Dst UTSW 1 34,206,421 (GRCm39) missense probably damaging 1.00
R1707:Dst UTSW 1 34,206,727 (GRCm39) missense probably damaging 1.00
R1747:Dst UTSW 1 34,199,790 (GRCm39) missense probably damaging 1.00
R1760:Dst UTSW 1 34,267,684 (GRCm39) missense probably damaging 1.00
R1773:Dst UTSW 1 34,330,980 (GRCm39) missense probably damaging 0.99
R1793:Dst UTSW 1 34,191,552 (GRCm39) nonsense probably null
R1842:Dst UTSW 1 34,203,200 (GRCm39) missense probably null 0.98
R1869:Dst UTSW 1 34,291,913 (GRCm39) missense probably damaging 0.99
R1879:Dst UTSW 1 34,227,924 (GRCm39) missense probably benign 0.15
R1883:Dst UTSW 1 34,228,389 (GRCm39) missense possibly damaging 0.74
R1912:Dst UTSW 1 34,330,931 (GRCm39) missense probably damaging 1.00
R1920:Dst UTSW 1 34,200,110 (GRCm39) missense probably damaging 0.99
R1921:Dst UTSW 1 34,200,110 (GRCm39) missense probably damaging 0.99
R1943:Dst UTSW 1 34,267,450 (GRCm39) missense possibly damaging 0.67
R1958:Dst UTSW 1 34,202,802 (GRCm39) missense probably damaging 1.00
R1962:Dst UTSW 1 34,230,097 (GRCm39) missense possibly damaging 0.47
R1991:Dst UTSW 1 34,229,339 (GRCm39) missense probably benign 0.11
R1998:Dst UTSW 1 34,295,428 (GRCm39) missense probably damaging 1.00
R2001:Dst UTSW 1 34,223,144 (GRCm39) missense probably damaging 0.97
R2007:Dst UTSW 1 34,265,093 (GRCm39) splice site probably benign
R2021:Dst UTSW 1 34,205,372 (GRCm39) missense possibly damaging 0.70
R2022:Dst UTSW 1 34,205,372 (GRCm39) missense possibly damaging 0.70
R2035:Dst UTSW 1 34,310,494 (GRCm39) missense probably damaging 1.00
R2077:Dst UTSW 1 34,250,251 (GRCm39) missense probably damaging 1.00
R2103:Dst UTSW 1 34,229,339 (GRCm39) missense probably benign 0.11
R2111:Dst UTSW 1 34,208,259 (GRCm39) missense probably damaging 1.00
R2112:Dst UTSW 1 34,208,259 (GRCm39) missense probably damaging 1.00
R2113:Dst UTSW 1 34,314,317 (GRCm39) missense probably damaging 0.97
R2201:Dst UTSW 1 34,235,002 (GRCm39) missense possibly damaging 0.60
R2214:Dst UTSW 1 34,310,482 (GRCm39) missense probably damaging 1.00
R2219:Dst UTSW 1 34,209,514 (GRCm39) missense probably damaging 1.00
R2233:Dst UTSW 1 34,313,343 (GRCm39) missense probably damaging 1.00
R2267:Dst UTSW 1 34,334,547 (GRCm39) missense probably damaging 1.00
R2290:Dst UTSW 1 34,268,281 (GRCm39) missense probably damaging 1.00
R2323:Dst UTSW 1 34,267,518 (GRCm39) missense possibly damaging 0.93
R2424:Dst UTSW 1 34,206,141 (GRCm39) missense probably damaging 1.00
R2426:Dst UTSW 1 34,231,893 (GRCm39) missense probably benign 0.03
R2495:Dst UTSW 1 34,238,454 (GRCm39) missense probably damaging 0.99
R2507:Dst UTSW 1 34,227,498 (GRCm39) missense possibly damaging 0.85
R2507:Dst UTSW 1 34,050,990 (GRCm39) missense probably damaging 0.98
R2510:Dst UTSW 1 34,251,367 (GRCm39) missense probably benign
R2831:Dst UTSW 1 34,314,373 (GRCm39) missense probably damaging 1.00
R2929:Dst UTSW 1 34,206,143 (GRCm39) nonsense probably null
R3033:Dst UTSW 1 34,191,366 (GRCm39) missense probably damaging 0.99
R3121:Dst UTSW 1 34,328,729 (GRCm39) missense probably damaging 1.00
R3424:Dst UTSW 1 34,237,586 (GRCm39) splice site probably benign
R3437:Dst UTSW 1 34,229,303 (GRCm39) missense probably damaging 1.00
R3699:Dst UTSW 1 34,252,155 (GRCm39) splice site probably benign
R3739:Dst UTSW 1 34,307,975 (GRCm39) splice site probably benign
R3796:Dst UTSW 1 34,220,996 (GRCm39) missense probably benign 0.15
R3847:Dst UTSW 1 34,251,400 (GRCm39) missense probably damaging 1.00
R3848:Dst UTSW 1 34,251,400 (GRCm39) missense probably damaging 1.00
R3849:Dst UTSW 1 34,251,400 (GRCm39) missense probably damaging 1.00
R3850:Dst UTSW 1 34,228,355 (GRCm39) nonsense probably null
R3850:Dst UTSW 1 34,251,400 (GRCm39) missense probably damaging 1.00
R3873:Dst UTSW 1 34,328,701 (GRCm39) missense probably damaging 1.00
R3875:Dst UTSW 1 34,210,328 (GRCm39) missense probably damaging 1.00
R3973:Dst UTSW 1 34,050,979 (GRCm39) missense probably benign 0.34
R4014:Dst UTSW 1 34,230,363 (GRCm39) nonsense probably null
R4043:Dst UTSW 1 34,229,765 (GRCm39) missense probably benign 0.03
R4057:Dst UTSW 1 34,225,135 (GRCm39) splice site probably benign
R4074:Dst UTSW 1 34,267,542 (GRCm39) missense probably damaging 0.97
R4074:Dst UTSW 1 34,231,350 (GRCm39) missense probably benign 0.20
R4075:Dst UTSW 1 34,231,350 (GRCm39) missense probably benign 0.20
R4076:Dst UTSW 1 34,231,350 (GRCm39) missense probably benign 0.20
R4206:Dst UTSW 1 34,251,328 (GRCm39) missense probably damaging 1.00
R4230:Dst UTSW 1 34,234,909 (GRCm39) missense probably benign 0.04
R4242:Dst UTSW 1 34,045,297 (GRCm39) missense possibly damaging 0.88
R4273:Dst UTSW 1 34,231,421 (GRCm39) missense possibly damaging 0.72
R4366:Dst UTSW 1 34,290,959 (GRCm39) missense probably damaging 1.00
R4370:Dst UTSW 1 34,290,809 (GRCm39) frame shift probably null
R4379:Dst UTSW 1 34,267,056 (GRCm39) missense probably benign 0.07
R4379:Dst UTSW 1 34,202,316 (GRCm39) missense probably damaging 1.00
R4380:Dst UTSW 1 34,202,316 (GRCm39) missense probably damaging 1.00
R4381:Dst UTSW 1 34,202,316 (GRCm39) missense probably damaging 1.00
R4423:Dst UTSW 1 34,227,474 (GRCm39) missense possibly damaging 0.76
R4427:Dst UTSW 1 34,220,541 (GRCm39) missense probably benign 0.19
R4456:Dst UTSW 1 34,229,800 (GRCm39) missense probably benign 0.06
R4469:Dst UTSW 1 34,230,923 (GRCm39) missense probably benign 0.02
R4502:Dst UTSW 1 34,286,772 (GRCm39) missense probably damaging 0.99
R4503:Dst UTSW 1 34,301,334 (GRCm39) critical splice donor site probably null
R4545:Dst UTSW 1 34,227,819 (GRCm39) missense probably damaging 0.99
R4610:Dst UTSW 1 34,208,937 (GRCm39) missense probably damaging 1.00
R4633:Dst UTSW 1 34,209,515 (GRCm39) missense probably damaging 1.00
R4675:Dst UTSW 1 34,314,784 (GRCm39) missense possibly damaging 0.94
R4687:Dst UTSW 1 34,240,204 (GRCm39) missense probably damaging 1.00
R4739:Dst UTSW 1 34,230,228 (GRCm39) missense probably benign 0.01
R4751:Dst UTSW 1 34,230,965 (GRCm39) missense probably benign 0.21
R4754:Dst UTSW 1 34,251,390 (GRCm39) missense probably damaging 1.00
R4771:Dst UTSW 1 34,288,565 (GRCm39) missense probably damaging 1.00
R4819:Dst UTSW 1 34,007,916 (GRCm39) missense probably benign 0.03
R4830:Dst UTSW 1 34,237,586 (GRCm39) splice site probably null
R4839:Dst UTSW 1 34,229,943 (GRCm39) missense probably damaging 0.96
R4845:Dst UTSW 1 34,232,208 (GRCm39) missense probably benign 0.02
R4904:Dst UTSW 1 34,208,879 (GRCm39) missense probably damaging 0.99
R4932:Dst UTSW 1 34,267,764 (GRCm39) missense possibly damaging 0.47
R4934:Dst UTSW 1 34,247,669 (GRCm39) missense probably damaging 1.00
R4952:Dst UTSW 1 34,310,503 (GRCm39) missense probably damaging 1.00
R4961:Dst UTSW 1 34,007,904 (GRCm39) missense possibly damaging 0.53
R4976:Dst UTSW 1 34,235,050 (GRCm39) nonsense probably null
R4980:Dst UTSW 1 34,295,369 (GRCm39) missense probably damaging 1.00
R5011:Dst UTSW 1 34,289,728 (GRCm39) missense probably damaging 1.00
R5013:Dst UTSW 1 34,289,728 (GRCm39) missense probably damaging 1.00
R5059:Dst UTSW 1 34,202,427 (GRCm39) missense possibly damaging 0.70
R5074:Dst UTSW 1 34,334,344 (GRCm39) missense probably damaging 1.00
R5114:Dst UTSW 1 34,241,640 (GRCm39) missense probably damaging 0.98
R5119:Dst UTSW 1 34,235,050 (GRCm39) nonsense probably null
R5182:Dst UTSW 1 34,218,167 (GRCm39) missense probably benign
R5236:Dst UTSW 1 34,203,498 (GRCm39) missense probably damaging 1.00
R5240:Dst UTSW 1 34,247,639 (GRCm39) nonsense probably null
R5254:Dst UTSW 1 34,217,012 (GRCm39) nonsense probably null
R5275:Dst UTSW 1 34,219,229 (GRCm39) missense probably benign 0.13
R5281:Dst UTSW 1 34,296,863 (GRCm39) missense probably benign 0.29
R5299:Dst UTSW 1 34,174,173 (GRCm39) missense probably damaging 1.00
R5316:Dst UTSW 1 34,262,929 (GRCm39) missense probably damaging 0.97
R5319:Dst UTSW 1 34,265,058 (GRCm39) missense possibly damaging 0.95
R5425:Dst UTSW 1 34,218,831 (GRCm39) missense probably benign 0.00
R5443:Dst UTSW 1 34,267,620 (GRCm39) missense probably damaging 1.00
R5522:Dst UTSW 1 34,296,954 (GRCm39) missense possibly damaging 0.46
R5537:Dst UTSW 1 34,228,959 (GRCm39) missense probably benign 0.25
R5548:Dst UTSW 1 34,228,409 (GRCm39) missense probably benign
R5557:Dst UTSW 1 34,321,667 (GRCm39) missense probably damaging 1.00
R5597:Dst UTSW 1 34,231,794 (GRCm39) missense probably benign 0.07
R5623:Dst UTSW 1 34,229,214 (GRCm39) missense possibly damaging 0.56
R5630:Dst UTSW 1 34,227,866 (GRCm39) frame shift probably null
R5660:Dst UTSW 1 34,321,574 (GRCm39) missense probably damaging 1.00
R5730:Dst UTSW 1 34,156,607 (GRCm39) splice site probably null
R5762:Dst UTSW 1 34,218,438 (GRCm39) missense probably damaging 0.99
R5810:Dst UTSW 1 34,222,121 (GRCm39) intron probably benign
R5816:Dst UTSW 1 34,218,315 (GRCm39) missense probably benign
R5846:Dst UTSW 1 34,234,942 (GRCm39) nonsense probably null
R5874:Dst UTSW 1 34,218,670 (GRCm39) missense probably damaging 0.98
R5899:Dst UTSW 1 34,334,370 (GRCm39) missense probably damaging 1.00
R5923:Dst UTSW 1 34,220,840 (GRCm39) missense probably benign 0.00
R5936:Dst UTSW 1 34,346,539 (GRCm39) missense probably damaging 1.00
R5946:Dst UTSW 1 34,213,273 (GRCm39) missense probably benign 0.01
R5950:Dst UTSW 1 34,301,141 (GRCm39) missense probably damaging 1.00
R5958:Dst UTSW 1 34,225,131 (GRCm39) missense probably damaging 0.97
R5973:Dst UTSW 1 34,195,938 (GRCm39) missense probably damaging 1.00
R5979:Dst UTSW 1 34,199,453 (GRCm39) intron probably benign
R5980:Dst UTSW 1 34,221,972 (GRCm39) missense probably benign 0.34
R5984:Dst UTSW 1 34,211,344 (GRCm39) missense probably benign 0.05
R6000:Dst UTSW 1 34,251,304 (GRCm39) missense possibly damaging 0.92
R6014:Dst UTSW 1 34,303,915 (GRCm39) missense probably damaging 1.00
R6042:Dst UTSW 1 34,228,053 (GRCm39) missense probably damaging 1.00
R6064:Dst UTSW 1 34,233,132 (GRCm39) missense probably damaging 1.00
R6126:Dst UTSW 1 34,267,264 (GRCm39) missense probably damaging 1.00
R6157:Dst UTSW 1 34,250,253 (GRCm39) missense probably damaging 1.00
R6162:Dst UTSW 1 34,045,318 (GRCm39) missense probably damaging 0.99
R6185:Dst UTSW 1 34,212,161 (GRCm39) missense probably damaging 0.99
R6226:Dst UTSW 1 34,309,955 (GRCm39) missense probably damaging 1.00
R6227:Dst UTSW 1 34,233,621 (GRCm39) missense probably benign 0.41
R6232:Dst UTSW 1 34,227,253 (GRCm39) missense probably damaging 1.00
R6259:Dst UTSW 1 34,221,477 (GRCm39) missense probably benign 0.26
R6267:Dst UTSW 1 34,267,753 (GRCm39) missense probably damaging 1.00
R6273:Dst UTSW 1 34,314,347 (GRCm39) missense probably damaging 1.00
R6284:Dst UTSW 1 34,268,166 (GRCm39) missense probably damaging 1.00
R6347:Dst UTSW 1 34,218,765 (GRCm39) splice site probably null
R6365:Dst UTSW 1 34,231,008 (GRCm39) missense probably damaging 1.00
R6385:Dst UTSW 1 34,346,549 (GRCm39) missense possibly damaging 0.85
R6389:Dst UTSW 1 34,232,265 (GRCm39) missense probably damaging 0.99
R6395:Dst UTSW 1 34,221,771 (GRCm39) missense probably benign 0.17
R6416:Dst UTSW 1 34,155,209 (GRCm39) missense probably damaging 1.00
R6467:Dst UTSW 1 34,334,277 (GRCm39) missense probably damaging 1.00
R6470:Dst UTSW 1 34,334,318 (GRCm39) missense probably damaging 1.00
R6477:Dst UTSW 1 34,247,809 (GRCm39) splice site probably null
R6485:Dst UTSW 1 34,333,610 (GRCm39) missense probably damaging 1.00
R6491:Dst UTSW 1 34,232,093 (GRCm39) missense probably benign 0.10
R6525:Dst UTSW 1 34,202,216 (GRCm39) missense probably damaging 1.00
R6533:Dst UTSW 1 34,342,590 (GRCm39) missense probably benign 0.08
R6595:Dst UTSW 1 34,289,761 (GRCm39) missense probably damaging 1.00
R6622:Dst UTSW 1 34,218,332 (GRCm39) missense probably benign 0.22
R6646:Dst UTSW 1 34,307,888 (GRCm39) missense possibly damaging 0.80
R6648:Dst UTSW 1 34,301,122 (GRCm39) missense possibly damaging 0.84
R6700:Dst UTSW 1 34,295,404 (GRCm39) missense probably damaging 1.00
R6743:Dst UTSW 1 34,309,971 (GRCm39) missense probably damaging 1.00
R6761:Dst UTSW 1 34,253,631 (GRCm39) missense probably damaging 1.00
R6766:Dst UTSW 1 34,333,564 (GRCm39) missense probably damaging 1.00
R6768:Dst UTSW 1 34,220,793 (GRCm39) missense probably damaging 0.98
R6810:Dst UTSW 1 34,251,379 (GRCm39) missense probably damaging 1.00
R6815:Dst UTSW 1 34,267,450 (GRCm39) missense possibly damaging 0.67
R6820:Dst UTSW 1 34,250,337 (GRCm39) missense probably damaging 1.00
R6822:Dst UTSW 1 34,314,755 (GRCm39) missense probably damaging 0.99
R6831:Dst UTSW 1 34,229,765 (GRCm39) missense probably benign 0.03
R6874:Dst UTSW 1 34,328,732 (GRCm39) missense probably benign 0.29
R6945:Dst UTSW 1 34,229,571 (GRCm39) missense probably damaging 1.00
R6985:Dst UTSW 1 34,229,934 (GRCm39) missense probably benign 0.08
R6995:Dst UTSW 1 34,205,315 (GRCm39) missense probably damaging 1.00
R7038:Dst UTSW 1 34,221,879 (GRCm39) nonsense probably null
R7043:Dst UTSW 1 34,296,992 (GRCm39) missense probably damaging 0.99
R7070:Dst UTSW 1 34,314,383 (GRCm39) missense probably damaging 1.00
R7097:Dst UTSW 1 34,208,341 (GRCm39) missense probably damaging 1.00
R7139:Dst UTSW 1 34,338,888 (GRCm39) missense probably damaging 0.97
R7144:Dst UTSW 1 34,191,324 (GRCm39) missense probably damaging 1.00
R7145:Dst UTSW 1 34,228,963 (GRCm39) missense probably benign
R7158:Dst UTSW 1 34,313,366 (GRCm39) missense probably benign
R7207:Dst UTSW 1 34,202,418 (GRCm39) missense probably damaging 0.98
R7320:Dst UTSW 1 34,230,175 (GRCm39) missense probably benign
R7324:Dst UTSW 1 34,045,305 (GRCm39) missense possibly damaging 0.93
R7327:Dst UTSW 1 34,240,486 (GRCm39) missense probably damaging 1.00
R7340:Dst UTSW 1 34,229,810 (GRCm39) missense probably benign 0.01
R7358:Dst UTSW 1 34,230,754 (GRCm39) missense probably benign
R7373:Dst UTSW 1 34,227,472 (GRCm39) missense probably benign 0.02
R7376:Dst UTSW 1 34,231,770 (GRCm39) missense probably benign
R7453:Dst UTSW 1 34,230,439 (GRCm39) missense possibly damaging 0.95
R7467:Dst UTSW 1 34,230,236 (GRCm39) missense probably benign 0.00
R7471:Dst UTSW 1 34,233,651 (GRCm39) missense possibly damaging 0.49
R7472:Dst UTSW 1 34,257,578 (GRCm39) missense probably benign 0.02
R7485:Dst UTSW 1 34,313,270 (GRCm39) missense probably benign 0.31
R7504:Dst UTSW 1 34,240,098 (GRCm39) missense probably damaging 1.00
R7516:Dst UTSW 1 34,209,560 (GRCm39) missense probably benign 0.10
R7524:Dst UTSW 1 34,330,974 (GRCm39) missense possibly damaging 0.94
R7528:Dst UTSW 1 34,333,603 (GRCm39) missense probably damaging 1.00
R7560:Dst UTSW 1 34,221,532 (GRCm39) missense possibly damaging 0.92
R7582:Dst UTSW 1 34,208,964 (GRCm39) missense probably damaging 1.00
R7585:Dst UTSW 1 34,153,096 (GRCm39) missense possibly damaging 0.50
R7594:Dst UTSW 1 34,252,094 (GRCm39) missense probably damaging 1.00
R7600:Dst UTSW 1 34,306,011 (GRCm39) missense probably damaging 1.00
R7619:Dst UTSW 1 34,238,509 (GRCm39) missense probably benign 0.02
R7623:Dst UTSW 1 34,209,517 (GRCm39) missense probably damaging 0.99
R7649:Dst UTSW 1 34,206,778 (GRCm39) missense probably benign 0.13
R7654:Dst UTSW 1 34,268,059 (GRCm39) missense probably damaging 1.00
R7654:Dst UTSW 1 34,268,058 (GRCm39) missense probably damaging 1.00
R7661:Dst UTSW 1 34,295,434 (GRCm39) critical splice donor site probably null
R7667:Dst UTSW 1 34,218,116 (GRCm39) missense possibly damaging 0.82
R7677:Dst UTSW 1 34,208,403 (GRCm39) critical splice donor site probably null
R7698:Dst UTSW 1 34,229,468 (GRCm39) missense probably benign 0.02
R7765:Dst UTSW 1 34,314,775 (GRCm39) missense probably damaging 0.97
R7772:Dst UTSW 1 34,220,469 (GRCm39) missense possibly damaging 0.90
R7779:Dst UTSW 1 34,233,678 (GRCm39) missense probably damaging 0.99
R7791:Dst UTSW 1 34,193,673 (GRCm39) missense probably damaging 0.99
R7821:Dst UTSW 1 34,314,443 (GRCm39) critical splice donor site probably null
R7834:Dst UTSW 1 34,233,186 (GRCm39) missense probably benign 0.22
R7935:Dst UTSW 1 34,329,486 (GRCm39) missense probably damaging 1.00
R7940:Dst UTSW 1 34,206,757 (GRCm39) missense possibly damaging 0.94
R7951:Dst UTSW 1 34,240,267 (GRCm39) missense probably benign
R7956:Dst UTSW 1 34,264,699 (GRCm39) missense probably damaging 1.00
R7970:Dst UTSW 1 34,221,828 (GRCm39) missense possibly damaging 0.80
R7982:Dst UTSW 1 34,221,621 (GRCm39) missense possibly damaging 0.89
R8048:Dst UTSW 1 34,229,717 (GRCm39) missense probably benign 0.00
R8052:Dst UTSW 1 34,323,444 (GRCm39) missense probably damaging 1.00
R8094:Dst UTSW 1 34,228,040 (GRCm39) missense possibly damaging 0.76
R8116:Dst UTSW 1 34,313,261 (GRCm39) missense probably benign 0.27
R8127:Dst UTSW 1 34,217,310 (GRCm39) missense probably damaging 1.00
R8139:Dst UTSW 1 34,230,933 (GRCm39) missense probably benign
R8205:Dst UTSW 1 34,253,685 (GRCm39) missense probably damaging 1.00
R8211:Dst UTSW 1 34,251,532 (GRCm39) missense probably damaging 1.00
R8237:Dst UTSW 1 34,208,874 (GRCm39) missense possibly damaging 0.96
R8265:Dst UTSW 1 34,217,603 (GRCm39) missense probably benign 0.13
R8309:Dst UTSW 1 34,156,592 (GRCm39) missense probably damaging 1.00
R8315:Dst UTSW 1 34,323,501 (GRCm39) critical splice donor site probably null
R8469:Dst UTSW 1 34,268,109 (GRCm39) missense probably damaging 1.00
R8474:Dst UTSW 1 34,208,266 (GRCm39) missense probably damaging 1.00
R8502:Dst UTSW 1 34,206,373 (GRCm39) missense probably damaging 1.00
R8534:Dst UTSW 1 34,229,388 (GRCm39) missense probably benign 0.12
R8535:Dst UTSW 1 34,225,082 (GRCm39) missense probably damaging 1.00
R8536:Dst UTSW 1 34,236,327 (GRCm39) missense possibly damaging 0.64
R8542:Dst UTSW 1 34,231,688 (GRCm39) missense possibly damaging 0.61
R8560:Dst UTSW 1 34,307,970 (GRCm39) missense probably damaging 1.00
R8737:Dst UTSW 1 34,267,750 (GRCm39) missense probably benign 0.00
R8742:Dst UTSW 1 34,251,425 (GRCm39) missense probably benign 0.01
R8882:Dst UTSW 1 34,240,005 (GRCm39) missense probably damaging 1.00
R8894:Dst UTSW 1 34,213,214 (GRCm39) missense possibly damaging 0.96
R8973:Dst UTSW 1 34,267,936 (GRCm39) missense probably damaging 1.00
R8977:Dst UTSW 1 34,286,864 (GRCm39) missense probably damaging 0.99
R8985:Dst UTSW 1 34,288,886 (GRCm39) missense probably benign 0.00
R9001:Dst UTSW 1 34,213,292 (GRCm39) missense possibly damaging 0.63
R9005:Dst UTSW 1 34,267,774 (GRCm39) missense probably damaging 0.99
R9013:Dst UTSW 1 34,217,165 (GRCm39) missense possibly damaging 0.46
R9015:Dst UTSW 1 34,326,337 (GRCm39) missense probably benign 0.00
R9018:Dst UTSW 1 34,235,140 (GRCm39) missense probably damaging 0.97
R9023:Dst UTSW 1 34,153,105 (GRCm39) critical splice donor site probably null
R9025:Dst UTSW 1 34,227,585 (GRCm39) missense possibly damaging 0.73
R9052:Dst UTSW 1 34,236,411 (GRCm39) nonsense probably null
R9052:Dst UTSW 1 34,206,045 (GRCm39) missense probably damaging 1.00
R9147:Dst UTSW 1 34,228,149 (GRCm39) missense probably damaging 0.99
R9169:Dst UTSW 1 34,303,652 (GRCm39) missense probably damaging 1.00
R9181:Dst UTSW 1 34,231,818 (GRCm39) missense probably benign
R9224:Dst UTSW 1 34,330,879 (GRCm39) missense probably damaging 1.00
R9245:Dst UTSW 1 34,228,943 (GRCm39) missense probably benign
R9267:Dst UTSW 1 34,232,145 (GRCm39) missense probably benign
R9302:Dst UTSW 1 34,264,636 (GRCm39) missense probably damaging 1.00
R9344:Dst UTSW 1 34,220,676 (GRCm39) missense probably damaging 0.99
R9363:Dst UTSW 1 34,235,060 (GRCm39) missense probably damaging 1.00
R9441:Dst UTSW 1 34,238,432 (GRCm39) missense probably damaging 1.00
R9477:Dst UTSW 1 34,205,292 (GRCm39) missense probably damaging 1.00
R9501:Dst UTSW 1 34,227,849 (GRCm39) missense probably damaging 0.98
R9509:Dst UTSW 1 33,947,465 (GRCm39) missense possibly damaging 0.72
R9572:Dst UTSW 1 34,250,252 (GRCm39) missense probably damaging 1.00
R9598:Dst UTSW 1 34,153,014 (GRCm39) missense possibly damaging 0.79
R9651:Dst UTSW 1 34,219,458 (GRCm39) missense probably benign 0.39
R9652:Dst UTSW 1 34,219,458 (GRCm39) missense probably benign 0.39
R9664:Dst UTSW 1 34,220,736 (GRCm39) missense probably benign 0.33
R9666:Dst UTSW 1 34,218,947 (GRCm39) nonsense probably null
R9707:Dst UTSW 1 34,228,934 (GRCm39) missense probably benign 0.28
R9721:Dst UTSW 1 34,231,866 (GRCm39) missense probably benign
R9727:Dst UTSW 1 34,314,877 (GRCm39) missense probably damaging 1.00
R9781:Dst UTSW 1 34,218,075 (GRCm39) missense probably benign
R9787:Dst UTSW 1 34,219,524 (GRCm39) missense probably benign 0.02
RF014:Dst UTSW 1 34,286,760 (GRCm39) missense probably benign 0.00
X0026:Dst UTSW 1 34,252,136 (GRCm39) missense probably damaging 0.97
X0028:Dst UTSW 1 34,231,280 (GRCm39) missense probably damaging 1.00
X0063:Dst UTSW 1 34,234,976 (GRCm39) missense probably damaging 1.00
X0066:Dst UTSW 1 34,314,784 (GRCm39) nonsense probably null
Z1176:Dst UTSW 1 34,283,526 (GRCm39) missense probably benign 0.02
Z1176:Dst UTSW 1 34,227,548 (GRCm39) nonsense probably null
Z1176:Dst UTSW 1 34,204,224 (GRCm39) missense probably benign 0.00
Z1176:Dst UTSW 1 34,314,289 (GRCm39) missense probably damaging 1.00
Z1177:Dst UTSW 1 34,233,599 (GRCm39) missense probably damaging 0.99
Z1177:Dst UTSW 1 34,220,313 (GRCm39) missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- GGCACCTGGCATTCTGATGAGATG -3'
(R):5'- TGGCCTAGCTGTGAACGGTAAAC -3'

Sequencing Primer
(F):5'- GCATTCTGATGAGATGCAGAGAC -3'
(R):5'- gagagagagagagagagagagag -3'
Posted On 2013-07-11