Mutagenetix > Incidental Mutations

Incidental Mutation 'R7745:Tas2r114'

596791

Institutional Source

Beutler Lab

Gene Symbol

Tas2r114

Ensembl Gene

ENSMUSG00000063478

Gene Name

taste receptor, type 2, member 114

Synonyms

mt2r46, mGR14, T2R14, Tas2r14

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.053) question?

Stock #

R7745 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

131689134-131690063 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 131689438 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 209 (M209K)

Ref Sequence

ENSEMBL: ENSMUSP00000079453 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000053652] [ENSMUST00000072404] [ENSMUST00000080619]

AlphaFold

Q7M722

Predicted Effect

probably benign
Transcript: ENSMUST00000053652

SMART Domains

Protein: ENSMUSP00000058006
Gene: ENSMUSG00000051153

Domain	Start	End	E-Value	Type
Pfam:TAS2R	1	298	9.4e-109	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000072404

SMART Domains

Protein: ENSMUSP00000072237
Gene: ENSMUSG00000061977

Domain	Start	End	E-Value	Type
Pfam:TAS2R	1	298	8.3e-102	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000080619
AA Change: M209K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000079453
Gene: ENSMUSG00000063478
AA Change: M209K

Domain	Start	End	E-Value	Type
Pfam:TAS2R	1	298	8.1e-104	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

96% (55/57)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product belongs to the family of candidate taste receptors that are members of the G-protein-coupled receptor superfamily. These proteins are specifically expressed in the taste receptor cells of the tongue and palate epithelia. They are organized in the genome in clusters and are genetically linked to loci that influence bitter perception in mice and humans. In functional expression studies, they respond to bitter tastants. This gene maps to the taste receptor gene cluster on chromosome 12p13. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aadac	A	C	3: 60,038,472	S188R	probably damaging	Het
Aars	T	A	8: 111,041,657	I220N	probably damaging	Het
Abca15	A	G	7: 120,332,217	N16S	probably damaging	Het
Adck1	A	T	12: 88,456,800	M358L	probably benign	Het
Adck5	A	T	15: 76,594,548	Q345L	probably benign	Het
Adgrl2	A	G	3: 148,836,458	F876S	probably damaging	Het
Aebp2	T	A	6: 140,623,858	L55Q	unknown	Het
Ampd2	C	A	3: 108,080,116	V134L	probably benign	Het
Aox3	T	C	1: 58,176,517	V1036A	possibly damaging	Het
Aox4	A	G	1: 58,240,707	D494G	probably benign	Het
Cacna1a	C	A	8: 84,559,394	H889Q	probably benign	Het
Cacna1c	T	C	6: 119,052,626	D151G		Het
Car8	A	G	4: 8,237,939	V92A	possibly damaging	Het
Ccdc8	G	T	7: 16,995,689	A368S	unknown	Het
Ccng2	C	G	5: 93,273,343	S237R	probably benign	Het
Cfap57	C	T	4: 118,614,931	V84I	probably benign	Het
Cntnap5a	A	G	1: 116,442,283	I877V	probably benign	Het
Copa	A	T	1: 172,111,942	D582V	probably damaging	Het
Cpne2	T	G	8: 94,568,684	S466A	probably damaging	Het
Crybg2	A	G	4: 134,088,845	K1311R	possibly damaging	Het
Csmd1	A	G	8: 15,932,461		probably null	Het
Dnah2	A	T	11: 69,451,318	C2947*	probably null	Het
Exoc1	A	T	5: 76,561,512	K656*	probably null	Het
Exoc8	T	C	8: 124,895,819	N603S	probably benign	Het
Fam171a1	T	A	2: 3,225,446	C539S	possibly damaging	Het
Fastkd5	A	T	2: 130,615,068	I534K	probably damaging	Het
Fbn1	T	C	2: 125,303,195	D2708G	probably benign	Het
Fhad1	A	G	4: 141,890,939	L1392P	probably benign	Het
Fras1	A	T	5: 96,726,895	T2306S	probably benign	Het
Gdf7	G	T	12: 8,301,854	A27E	unknown	Het
Hnrnph1	A	T	11: 50,379,497	I43F	probably damaging	Het
Igkv8-27	T	A	6: 70,172,015	S52C	probably benign	Het
Jmjd1c	T	C	10: 67,217,045	F24L	probably damaging	Het
Knl1	T	G	2: 119,071,556	L1246R	probably benign	Het
Limk2	C	T	11: 3,355,896	S191N	probably damaging	Het
Mdga2	G	A	12: 66,689,350	A368V	probably damaging	Het
Mdga2	C	A	12: 66,689,351	A368S	possibly damaging	Het
Med24	A	T	11: 98,704,967	L966Q	probably damaging	Het
Mgll	T	C	6: 88,725,788	V23A	possibly damaging	Het
Nedd1	C	T	10: 92,714,172	D84N	probably benign	Het
Obscn	A	C	11: 59,060,855	L4024R	probably damaging	Het
Olfr172	A	T	16: 58,760,419	Y252*	probably null	Het
Pcnx2	T	C	8: 125,851,107	I944V	probably benign	Het
Pecr	T	C	1: 72,266,998		probably null	Het
Phf3	A	T	1: 30,804,224	W1885R	probably damaging	Het
Pitpnm2	C	G	5: 124,128,705	A697P	probably benign	Het
Piwil2	T	A	14: 70,394,189	H602L	probably benign	Het
Pprc1	T	C	19: 46,065,342	S1104P	unknown	Het
Prkar1a	T	A	11: 109,653,847	Y21*	probably null	Het
Prl2c3	A	T	13: 12,798,297	Y9*	probably null	Het
Rhbdl3	T	A	11: 80,323,579	L172Q	possibly damaging	Het
Rsph3a	T	G	17: 7,979,243	L484W	probably damaging	Het
Sbno1	A	T	5: 124,392,899	S809T	probably benign	Het
Stmnd1	T	A	13: 46,299,601	V251E	possibly damaging	Het
Stt3a	A	T	9: 36,751,239	C241*	probably null	Het
Tchh	G	T	3: 93,444,777	R508L	unknown	Het
Tgfbr3l	T	C	8: 4,250,622	S267P	possibly damaging	Het
Ttn	T	A	2: 76,767,800	I19590F	probably damaging	Het
Vmn1r171	A	G	7: 23,632,610	T87A	probably benign	Het

Other mutations in Tas2r114

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01777:Tas2r114	APN	6	131689701	nonsense	probably null
IGL02971:Tas2r114	APN	6	131689280	missense	probably benign	0.00
R0561:Tas2r114	UTSW	6	131689795	missense	probably benign	0.30
R3034:Tas2r114	UTSW	6	131689648	missense	probably benign	0.15
R3687:Tas2r114	UTSW	6	131689268	missense	probably benign	0.25
R4411:Tas2r114	UTSW	6	131689622	missense	probably benign	0.06
R4826:Tas2r114	UTSW	6	131689837	missense	probably damaging	0.99
R4889:Tas2r114	UTSW	6	131689795	missense	probably damaging	0.96
R5084:Tas2r114	UTSW	6	131689288	nonsense	probably null
R5258:Tas2r114	UTSW	6	131689541	missense	probably benign	0.03
R6038:Tas2r114	UTSW	6	131689481	missense	possibly damaging	0.89
R6038:Tas2r114	UTSW	6	131689481	missense	possibly damaging	0.89
R6499:Tas2r114	UTSW	6	131689136	makesense	probably null
R7164:Tas2r114	UTSW	6	131689765	missense	possibly damaging	0.74
R7276:Tas2r114	UTSW	6	131689347	missense	probably damaging	0.96
R7851:Tas2r114	UTSW	6	131689925	missense	probably damaging	1.00
R8002:Tas2r114	UTSW	6	131689139	missense	probably damaging	1.00
R8901:Tas2r114	UTSW	6	131689951	missense	probably damaging	0.99
R9297:Tas2r114	UTSW	6	131689324	missense	probably damaging	0.96
R9380:Tas2r114	UTSW	6	131689418	missense	probably benign	0.00
R9402:Tas2r114	UTSW	6	131689931	missense	possibly damaging	0.49

Predicted Primers

PCR Primer
(F):5'- TTAGGATAAGTGAGTGGCAGCC -3'
(R):5'- CTTTCCCAGTTGTTGCGAAG -3'

Sequencing Primer
(F):5'- CCGGGATAGATGAATGCAGTTGTC -3'
(R):5'- CCAGTTGTTGCGAAGATGGTTAAAG -3'

Posted On

2019-11-26