Incidental Mutation 'R7745:Ccdc8'
ID596793
Institutional Source Beutler Lab
Gene Symbol Ccdc8
Ensembl Gene ENSMUSG00000041117
Gene Namecoiled-coil domain containing 8
SynonymsENSMUSG00000041117
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7745 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location16992708-16997516 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 16995689 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 368 (A368S)
Ref Sequence ENSEMBL: ENSMUSP00000092399 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094805]
Predicted Effect unknown
Transcript: ENSMUST00000094805
AA Change: A368S
SMART Domains Protein: ENSMUSP00000092399
Gene: ENSMUSG00000041117
AA Change: A368S

DomainStartEndE-ValueType
Pfam:PNMA 1 98 1.3e-19 PFAM
low complexity region 166 171 N/A INTRINSIC
internal_repeat_1 207 275 5.53e-5 PROSPERO
low complexity region 297 332 N/A INTRINSIC
low complexity region 335 420 N/A INTRINSIC
low complexity region 430 452 N/A INTRINSIC
low complexity region 458 468 N/A INTRINSIC
low complexity region 478 540 N/A INTRINSIC
internal_repeat_1 566 640 5.53e-5 PROSPERO
low complexity region 646 658 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 96% (55/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a coiled-coil domain-containing protein. The encoded protein functions as a cofactor required for p53-mediated apoptosis following DNA damage, and may also play a role in growth through interactions with the cytoskeletal adaptor protein obscurin-like 1. Mutations in this gene are a cause of 3M syndrome-3 (3M3). [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadac A C 3: 60,038,472 S188R probably damaging Het
Aars T A 8: 111,041,657 I220N probably damaging Het
Abca15 A G 7: 120,332,217 N16S probably damaging Het
Adck1 A T 12: 88,456,800 M358L probably benign Het
Adck5 A T 15: 76,594,548 Q345L probably benign Het
Adgrl2 A G 3: 148,836,458 F876S probably damaging Het
Aebp2 T A 6: 140,623,858 L55Q unknown Het
Ampd2 C A 3: 108,080,116 V134L probably benign Het
Aox3 T C 1: 58,176,517 V1036A possibly damaging Het
Aox4 A G 1: 58,240,707 D494G probably benign Het
Cacna1a C A 8: 84,559,394 H889Q probably benign Het
Cacna1c T C 6: 119,052,626 D151G Het
Car8 A G 4: 8,237,939 V92A possibly damaging Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Cfap57 C T 4: 118,614,931 V84I probably benign Het
Cntnap5a A G 1: 116,442,283 I877V probably benign Het
Copa A T 1: 172,111,942 D582V probably damaging Het
Cpne2 T G 8: 94,568,684 S466A probably damaging Het
Crybg2 A G 4: 134,088,845 K1311R possibly damaging Het
Csmd1 A G 8: 15,932,461 probably null Het
Dnah2 A T 11: 69,451,318 C2947* probably null Het
Exoc1 A T 5: 76,561,512 K656* probably null Het
Exoc8 T C 8: 124,895,819 N603S probably benign Het
Fam171a1 T A 2: 3,225,446 C539S possibly damaging Het
Fastkd5 A T 2: 130,615,068 I534K probably damaging Het
Fbn1 T C 2: 125,303,195 D2708G probably benign Het
Fhad1 A G 4: 141,890,939 L1392P probably benign Het
Fras1 A T 5: 96,726,895 T2306S probably benign Het
Gdf7 G T 12: 8,301,854 A27E unknown Het
Hnrnph1 A T 11: 50,379,497 I43F probably damaging Het
Igkv8-27 T A 6: 70,172,015 S52C probably benign Het
Jmjd1c T C 10: 67,217,045 F24L probably damaging Het
Knl1 T G 2: 119,071,556 L1246R probably benign Het
Limk2 C T 11: 3,355,896 S191N probably damaging Het
Mdga2 G A 12: 66,689,350 A368V probably damaging Het
Mdga2 C A 12: 66,689,351 A368S possibly damaging Het
Med24 A T 11: 98,704,967 L966Q probably damaging Het
Mgll T C 6: 88,725,788 V23A possibly damaging Het
Nedd1 C T 10: 92,714,172 D84N probably benign Het
Obscn A C 11: 59,060,855 L4024R probably damaging Het
Olfr172 A T 16: 58,760,419 Y252* probably null Het
Pcnx2 T C 8: 125,851,107 I944V probably benign Het
Pecr T C 1: 72,266,998 probably null Het
Phf3 A T 1: 30,804,224 W1885R probably damaging Het
Pitpnm2 C G 5: 124,128,705 A697P probably benign Het
Piwil2 T A 14: 70,394,189 H602L probably benign Het
Pprc1 T C 19: 46,065,342 S1104P unknown Het
Prkar1a T A 11: 109,653,847 Y21* probably null Het
Prl2c3 A T 13: 12,798,297 Y9* probably null Het
Rhbdl3 T A 11: 80,323,579 L172Q possibly damaging Het
Rsph3a T G 17: 7,979,243 L484W probably damaging Het
Sbno1 A T 5: 124,392,899 S809T probably benign Het
Stmnd1 T A 13: 46,299,601 V251E possibly damaging Het
Stt3a A T 9: 36,751,239 C241* probably null Het
Tas2r114 A T 6: 131,689,438 M209K probably damaging Het
Tchh G T 3: 93,444,777 R508L unknown Het
Tgfbr3l T C 8: 4,250,622 S267P possibly damaging Het
Ttn T A 2: 76,767,800 I19590F probably damaging Het
Vmn1r171 A G 7: 23,632,610 T87A probably benign Het
Other mutations in Ccdc8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Ccdc8 APN 7 16996042 missense unknown
R0255:Ccdc8 UTSW 7 16995657 missense unknown
R0504:Ccdc8 UTSW 7 16996014 missense unknown
R3843:Ccdc8 UTSW 7 16995114 missense probably damaging 1.00
R5054:Ccdc8 UTSW 7 16995045 missense probably damaging 1.00
R6020:Ccdc8 UTSW 7 16996581 missense probably damaging 0.99
R6045:Ccdc8 UTSW 7 16996031 missense unknown
R6244:Ccdc8 UTSW 7 16996251 missense probably benign 0.04
R6753:Ccdc8 UTSW 7 16996637 nonsense probably null
R7299:Ccdc8 UTSW 7 16996031 missense unknown
R7567:Ccdc8 UTSW 7 16994762 missense probably damaging 1.00
R7623:Ccdc8 UTSW 7 16996612 missense possibly damaging 0.70
R8310:Ccdc8 UTSW 7 16995401 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTCCCTGAGACGATGCAG -3'
(R):5'- TCTGCCTTCTGGTTAGCAGC -3'

Sequencing Primer
(F):5'- TTCGCTCAGGGAACAGGCATG -3'
(R):5'- TCTGGTTAGCAGCAGCCTCTG -3'
Posted On2019-11-26