Incidental Mutation 'R7745:Vmn1r171'
ID596794
Institutional Source Beutler Lab
Gene Symbol Vmn1r171
Ensembl Gene ENSMUSG00000062483
Gene Namevomeronasal 1 receptor 171
SynonymsV3R7, V1rd7
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R7745 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location23630722-23634370 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 23632610 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 87 (T87A)
Ref Sequence ENSEMBL: ENSMUSP00000077552 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078458] [ENSMUST00000226128] [ENSMUST00000226321] [ENSMUST00000226733] [ENSMUST00000226771] [ENSMUST00000227386] [ENSMUST00000227774] [ENSMUST00000227866] [ENSMUST00000228228] [ENSMUST00000228484] [ENSMUST00000228559] [ENSMUST00000228674] [ENSMUST00000228681]
Predicted Effect probably benign
Transcript: ENSMUST00000078458
AA Change: T87A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000077552
Gene: ENSMUSG00000062483
AA Change: T87A

DomainStartEndE-ValueType
Pfam:TAS2R 20 307 1.7e-14 PFAM
Pfam:7tm_1 42 300 3.4e-7 PFAM
Pfam:V1R 53 307 1.1e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000226128
AA Change: T75A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000226321
AA Change: T75A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000226733
AA Change: T75A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000226771
AA Change: T75A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000227386
AA Change: T75A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000227774
AA Change: T75A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000227866
AA Change: T75A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000228228
AA Change: T75A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000228484
AA Change: T75A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000228559
AA Change: T75A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000228674
AA Change: T75A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000228681
AA Change: T75A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadac A C 3: 60,038,472 S188R probably damaging Het
Aars T A 8: 111,041,657 I220N probably damaging Het
Abca15 A G 7: 120,332,217 N16S probably damaging Het
Adck1 A T 12: 88,456,800 M358L probably benign Het
Adck5 A T 15: 76,594,548 Q345L probably benign Het
Adgrl2 A G 3: 148,836,458 F876S probably damaging Het
Aebp2 T A 6: 140,623,858 L55Q unknown Het
Ampd2 C A 3: 108,080,116 V134L probably benign Het
Aox3 T C 1: 58,176,517 V1036A possibly damaging Het
Aox4 A G 1: 58,240,707 D494G probably benign Het
Cacna1a C A 8: 84,559,394 H889Q probably benign Het
Cacna1c T C 6: 119,052,626 D151G Het
Car8 A G 4: 8,237,939 V92A possibly damaging Het
Ccdc8 G T 7: 16,995,689 A368S unknown Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Cfap57 C T 4: 118,614,931 V84I not run Het
Cntnap5a A G 1: 116,442,283 I877V probably benign Het
Copa A T 1: 172,111,942 D582V probably damaging Het
Cpne2 T G 8: 94,568,684 S466A probably damaging Het
Crybg2 A G 4: 134,088,845 K1311R possibly damaging Het
Csmd1 A G 8: 15,932,461 probably null Het
Dnah2 A T 11: 69,451,318 C2947* probably null Het
Exoc1 A T 5: 76,561,512 K656* probably null Het
Exoc8 T C 8: 124,895,819 N603S probably benign Het
Fam171a1 T A 2: 3,225,446 C539S possibly damaging Het
Fastkd5 A T 2: 130,615,068 I534K probably damaging Het
Fbn1 T C 2: 125,303,195 D2708G probably benign Het
Fhad1 A G 4: 141,890,939 L1392P probably benign Het
Fras1 A T 5: 96,726,895 T2306S probably benign Het
Gdf7 G T 12: 8,301,854 A27E unknown Het
Hnrnph1 A T 11: 50,379,497 I43F probably damaging Het
Igkv8-27 T A 6: 70,172,015 S52C probably benign Het
Jmjd1c T C 10: 67,217,045 F24L probably damaging Het
Knl1 T G 2: 119,071,556 L1246R probably benign Het
Limk2 C T 11: 3,355,896 S191N probably damaging Het
Mdga2 G A 12: 66,689,350 A368V probably damaging Het
Mdga2 C A 12: 66,689,351 A368S possibly damaging Het
Med24 A T 11: 98,704,967 L966Q probably damaging Het
Mgll T C 6: 88,725,788 V23A possibly damaging Het
Nedd1 C T 10: 92,714,172 D84N probably benign Het
Obscn A C 11: 59,060,855 L4024R probably damaging Het
Olfr172 A T 16: 58,760,419 Y252* probably null Het
Pcnx2 T C 8: 125,851,107 I944V probably benign Het
Phf3 A T 1: 30,804,224 W1885R probably damaging Het
Pitpnm2 C G 5: 124,128,705 A697P probably benign Het
Piwil2 T A 14: 70,394,189 H602L probably benign Het
Pprc1 T C 19: 46,065,342 S1104P unknown Het
Prkar1a T A 11: 109,653,847 Y21* probably null Het
Rhbdl3 T A 11: 80,323,579 L172Q possibly damaging Het
Rsph3a T G 17: 7,979,243 L484W probably damaging Het
Sbno1 A T 5: 124,392,899 S809T probably benign Het
Stmnd1 T A 13: 46,299,601 V251E possibly damaging Het
Stt3a A T 9: 36,751,239 C241* probably null Het
Tas2r114 A T 6: 131,689,438 M209K probably damaging Het
Tchh G T 3: 93,444,777 R508L unknown Het
Tgfbr3l T C 8: 4,250,622 S267P possibly damaging Het
Ttn T A 2: 76,767,800 I19590F probably damaging Het
Other mutations in Vmn1r171
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01088:Vmn1r171 APN 7 23632827 missense probably damaging 1.00
IGL02963:Vmn1r171 APN 7 23632688 missense possibly damaging 0.62
FR4304:Vmn1r171 UTSW 7 23632680 missense probably benign 0.26
R0412:Vmn1r171 UTSW 7 23632655 missense possibly damaging 0.81
R0602:Vmn1r171 UTSW 7 23633177 missense probably benign 0.01
R0710:Vmn1r171 UTSW 7 23633001 missense probably damaging 1.00
R1758:Vmn1r171 UTSW 7 23632356 missense probably benign 0.25
R2007:Vmn1r171 UTSW 7 23632587 missense probably damaging 1.00
R4153:Vmn1r171 UTSW 7 23632652 missense probably damaging 1.00
R4799:Vmn1r171 UTSW 7 23632944 missense probably benign 0.31
R5038:Vmn1r171 UTSW 7 23632763 missense probably benign 0.00
R6087:Vmn1r171 UTSW 7 23633004 missense probably damaging 1.00
R6906:Vmn1r171 UTSW 7 23632379 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGATCCTCTTGCTTTGCCAGG -3'
(R):5'- TGACTTTCATTGGAATGTGAGC -3'

Sequencing Primer
(F):5'- CCAGGTTGGGGTTGGAAC -3'
(R):5'- TACCTCACAAATTTGGGGGC -3'
Posted On2019-11-26