Incidental Mutation 'R7745:Jmjd1c'
ID596804
Institutional Source Beutler Lab
Gene Symbol Jmjd1c
Ensembl Gene ENSMUSG00000037876
Gene Namejumonji domain containing 1C
SynonymsTRIP8, D630035I23Rik, 5430433L24Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.719) question?
Stock #R7745 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location67096125-67256326 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 67217045 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 24 (F24L)
Ref Sequence ENSEMBL: ENSMUSP00000133700 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051446] [ENSMUST00000173689] [ENSMUST00000174317] [ENSMUST00000174408]
Predicted Effect possibly damaging
Transcript: ENSMUST00000051446
AA Change: F205L

PolyPhen 2 Score 0.925 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000056227
Gene: ENSMUSG00000037876
AA Change: F205L

DomainStartEndE-ValueType
Blast:JmjC 143 2236 N/A BLAST
JmjC 2264 2488 3.29e-53 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000173689
AA Change: F24L

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000133700
Gene: ENSMUSG00000037876
AA Change: F24L

DomainStartEndE-ValueType
Blast:JmjC 1 2056 N/A BLAST
JmjC 2084 2308 3.29e-53 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174317
SMART Domains Protein: ENSMUSP00000134246
Gene: ENSMUSG00000037876

DomainStartEndE-ValueType
Blast:JmjC 1 744 N/A BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000174408
AA Change: F205L

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000134551
Gene: ENSMUSG00000037876
AA Change: F205L

DomainStartEndE-ValueType
Blast:JmjC 143 2237 N/A BLAST
JmjC 2265 2489 3.29e-53 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 96% (55/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene interacts with thyroid hormone receptors and contains a jumonji domain. It is a candidate histone demethylase and is thought to be a coactivator for key transcription factors. It plays a role in the DNA-damage response pathway by demethylating the mediator of DNA damage checkpoint 1 (MDC1) protein, and is required for the survival of acute myeloid leukemia. Mutations in this gene are associated with Rett syndrome and intellectual disability. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit an age-dependent male infertility phenotype, characterized by early loss of undifferentiated spermatogonia, and a progressive reduction in testis size/weight and male germ cells, partly due to increased male germ cell apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadac A C 3: 60,038,472 S188R probably damaging Het
Aars T A 8: 111,041,657 I220N probably damaging Het
Abca15 A G 7: 120,332,217 N16S probably damaging Het
Adck1 A T 12: 88,456,800 M358L probably benign Het
Adck5 A T 15: 76,594,548 Q345L probably benign Het
Adgrl2 A G 3: 148,836,458 F876S probably damaging Het
Aebp2 T A 6: 140,623,858 L55Q unknown Het
Ampd2 C A 3: 108,080,116 V134L probably benign Het
Aox3 T C 1: 58,176,517 V1036A possibly damaging Het
Aox4 A G 1: 58,240,707 D494G probably benign Het
Cacna1a C A 8: 84,559,394 H889Q probably benign Het
Cacna1c T C 6: 119,052,626 D151G Het
Car8 A G 4: 8,237,939 V92A possibly damaging Het
Ccdc8 G T 7: 16,995,689 A368S unknown Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Cfap57 C T 4: 118,614,931 V84I probably benign Het
Cntnap5a A G 1: 116,442,283 I877V probably benign Het
Copa A T 1: 172,111,942 D582V probably damaging Het
Cpne2 T G 8: 94,568,684 S466A probably damaging Het
Crybg2 A G 4: 134,088,845 K1311R possibly damaging Het
Csmd1 A G 8: 15,932,461 probably null Het
Dnah2 A T 11: 69,451,318 C2947* probably null Het
Exoc1 A T 5: 76,561,512 K656* probably null Het
Exoc8 T C 8: 124,895,819 N603S probably benign Het
Fam171a1 T A 2: 3,225,446 C539S possibly damaging Het
Fastkd5 A T 2: 130,615,068 I534K probably damaging Het
Fbn1 T C 2: 125,303,195 D2708G probably benign Het
Fhad1 A G 4: 141,890,939 L1392P probably benign Het
Fras1 A T 5: 96,726,895 T2306S probably benign Het
Gdf7 G T 12: 8,301,854 A27E unknown Het
Hnrnph1 A T 11: 50,379,497 I43F probably damaging Het
Igkv8-27 T A 6: 70,172,015 S52C probably benign Het
Knl1 T G 2: 119,071,556 L1246R probably benign Het
Limk2 C T 11: 3,355,896 S191N probably damaging Het
Mdga2 G A 12: 66,689,350 A368V probably damaging Het
Mdga2 C A 12: 66,689,351 A368S possibly damaging Het
Med24 A T 11: 98,704,967 L966Q probably damaging Het
Mgll T C 6: 88,725,788 V23A possibly damaging Het
Nedd1 C T 10: 92,714,172 D84N probably benign Het
Obscn A C 11: 59,060,855 L4024R probably damaging Het
Olfr172 A T 16: 58,760,419 Y252* probably null Het
Pcnx2 T C 8: 125,851,107 I944V probably benign Het
Pecr T C 1: 72,266,998 probably null Het
Phf3 A T 1: 30,804,224 W1885R probably damaging Het
Pitpnm2 C G 5: 124,128,705 A697P probably benign Het
Piwil2 T A 14: 70,394,189 H602L probably benign Het
Pprc1 T C 19: 46,065,342 S1104P unknown Het
Prkar1a T A 11: 109,653,847 Y21* probably null Het
Prl2c3 A T 13: 12,798,297 Y9* probably null Het
Rhbdl3 T A 11: 80,323,579 L172Q possibly damaging Het
Rsph3a T G 17: 7,979,243 L484W probably damaging Het
Sbno1 A T 5: 124,392,899 S809T probably benign Het
Stmnd1 T A 13: 46,299,601 V251E possibly damaging Het
Stt3a A T 9: 36,751,239 C241* probably null Het
Tas2r114 A T 6: 131,689,438 M209K probably damaging Het
Tchh G T 3: 93,444,777 R508L unknown Het
Tgfbr3l T C 8: 4,250,622 S267P possibly damaging Het
Ttn T A 2: 76,767,800 I19590F probably damaging Het
Vmn1r171 A G 7: 23,632,610 T87A probably benign Het
Other mutations in Jmjd1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01062:Jmjd1c APN 10 67226715 missense probably damaging 1.00
IGL01604:Jmjd1c APN 10 67249762 missense probably damaging 1.00
IGL01753:Jmjd1c APN 10 67232015 missense probably damaging 1.00
IGL02081:Jmjd1c APN 10 67219526 missense probably benign 0.02
IGL02128:Jmjd1c APN 10 67243869 missense probably damaging 1.00
IGL02134:Jmjd1c APN 10 67220392 missense possibly damaging 0.87
IGL02215:Jmjd1c APN 10 67220322 missense probably damaging 1.00
IGL02408:Jmjd1c APN 10 67226382 missense probably benign 0.00
IGL02502:Jmjd1c APN 10 67225861 missense probably benign 0.13
IGL02546:Jmjd1c APN 10 67225336 missense possibly damaging 0.94
IGL02943:Jmjd1c APN 10 67219654 missense probably damaging 0.99
IGL03171:Jmjd1c APN 10 67225498 missense possibly damaging 0.89
IGL03261:Jmjd1c APN 10 67232070 missense probably damaging 0.99
Accordion UTSW 10 67233414 missense probably damaging 0.99
PIT4378001:Jmjd1c UTSW 10 67229913 missense probably damaging 1.00
R0126:Jmjd1c UTSW 10 67219326 missense probably damaging 0.98
R0133:Jmjd1c UTSW 10 67240808 missense probably benign 0.22
R0201:Jmjd1c UTSW 10 67219109 missense unknown
R0396:Jmjd1c UTSW 10 67219523 missense possibly damaging 0.82
R0401:Jmjd1c UTSW 10 67220382 missense probably damaging 1.00
R0452:Jmjd1c UTSW 10 67255482 missense probably benign 0.28
R0488:Jmjd1c UTSW 10 67240727 missense probably damaging 0.99
R0504:Jmjd1c UTSW 10 67225755 missense probably damaging 1.00
R0555:Jmjd1c UTSW 10 67225789 missense probably benign 0.01
R0673:Jmjd1c UTSW 10 67226809 missense probably damaging 1.00
R0718:Jmjd1c UTSW 10 67218946 splice site probably null
R0755:Jmjd1c UTSW 10 67096599 intron probably benign
R1142:Jmjd1c UTSW 10 67225345 missense probably damaging 1.00
R1196:Jmjd1c UTSW 10 67239236 splice site probably benign
R1413:Jmjd1c UTSW 10 67249750 missense probably damaging 1.00
R1619:Jmjd1c UTSW 10 67219875 missense probably benign 0.25
R1676:Jmjd1c UTSW 10 67224809 missense probably benign 0.02
R1751:Jmjd1c UTSW 10 67225690 missense probably benign
R1950:Jmjd1c UTSW 10 67239922 missense possibly damaging 0.71
R1968:Jmjd1c UTSW 10 67225440 missense probably damaging 1.00
R2049:Jmjd1c UTSW 10 67157998 nonsense probably null
R2061:Jmjd1c UTSW 10 67218426 missense probably damaging 1.00
R2202:Jmjd1c UTSW 10 67239463 splice site probably null
R2203:Jmjd1c UTSW 10 67239463 splice site probably null
R2256:Jmjd1c UTSW 10 67225294 missense probably damaging 1.00
R2312:Jmjd1c UTSW 10 67238850 missense probably damaging 0.98
R2349:Jmjd1c UTSW 10 67255500 missense probably benign
R2392:Jmjd1c UTSW 10 67229904 missense probably damaging 1.00
R3015:Jmjd1c UTSW 10 67157932 missense probably damaging 1.00
R3110:Jmjd1c UTSW 10 67240084 splice site probably benign
R4043:Jmjd1c UTSW 10 67219466 missense possibly damaging 0.55
R4097:Jmjd1c UTSW 10 67219008 missense probably benign 0.09
R4118:Jmjd1c UTSW 10 67219753 missense probably damaging 0.96
R4193:Jmjd1c UTSW 10 67096681 intron probably benign
R4352:Jmjd1c UTSW 10 67244809 missense probably damaging 1.00
R4577:Jmjd1c UTSW 10 67249750 missense probably damaging 1.00
R4630:Jmjd1c UTSW 10 67157974 nonsense probably null
R4717:Jmjd1c UTSW 10 67158051 nonsense probably null
R4741:Jmjd1c UTSW 10 67224939 missense possibly damaging 0.56
R4774:Jmjd1c UTSW 10 67224792 missense possibly damaging 0.45
R4836:Jmjd1c UTSW 10 67233446 missense probably benign 0.21
R4914:Jmjd1c UTSW 10 67218971 missense probably damaging 1.00
R4939:Jmjd1c UTSW 10 67246137 missense possibly damaging 0.93
R5211:Jmjd1c UTSW 10 67232016 missense probably damaging 1.00
R5215:Jmjd1c UTSW 10 67240701 missense possibly damaging 0.93
R5514:Jmjd1c UTSW 10 67218149 missense probably damaging 1.00
R5530:Jmjd1c UTSW 10 67249762 missense probably damaging 1.00
R5624:Jmjd1c UTSW 10 67233414 missense probably damaging 0.99
R5640:Jmjd1c UTSW 10 67226078 missense probably benign 0.10
R5654:Jmjd1c UTSW 10 67230006 missense probably benign 0.10
R5742:Jmjd1c UTSW 10 67220333 missense probably benign 0.02
R5764:Jmjd1c UTSW 10 67226512 missense probably damaging 1.00
R6118:Jmjd1c UTSW 10 67240012 missense probably damaging 1.00
R6163:Jmjd1c UTSW 10 67248048 missense possibly damaging 0.46
R6256:Jmjd1c UTSW 10 67220408 missense probably damaging 1.00
R6266:Jmjd1c UTSW 10 67249660 missense probably damaging 0.96
R6358:Jmjd1c UTSW 10 67225939 missense probably benign
R6430:Jmjd1c UTSW 10 67224160 missense possibly damaging 0.87
R6455:Jmjd1c UTSW 10 67226016 missense probably benign 0.10
R6887:Jmjd1c UTSW 10 67189820 missense possibly damaging 0.74
R6895:Jmjd1c UTSW 10 67217090 missense probably benign 0.00
R7041:Jmjd1c UTSW 10 67220609 missense possibly damaging 0.90
R7095:Jmjd1c UTSW 10 67219632 missense probably benign 0.39
R7113:Jmjd1c UTSW 10 67158001 missense probably damaging 0.98
R7225:Jmjd1c UTSW 10 67226065 missense probably benign 0.00
R7249:Jmjd1c UTSW 10 67189817 missense probably benign 0.01
R7361:Jmjd1c UTSW 10 67218364 missense probably benign 0.10
R7383:Jmjd1c UTSW 10 67189758 missense probably benign 0.14
R7460:Jmjd1c UTSW 10 67217036 missense probably benign 0.24
R7475:Jmjd1c UTSW 10 67225313 missense probably benign 0.22
R7502:Jmjd1c UTSW 10 67232015 missense probably damaging 0.99
R7699:Jmjd1c UTSW 10 67218416 missense probably benign 0.10
R7897:Jmjd1c UTSW 10 67239865 missense probably damaging 0.96
R7908:Jmjd1c UTSW 10 67225842 missense probably benign
R7911:Jmjd1c UTSW 10 67231995 missense probably damaging 1.00
R7967:Jmjd1c UTSW 10 67249682 missense probably damaging 1.00
R8058:Jmjd1c UTSW 10 67254495 missense not run
R8224:Jmjd1c UTSW 10 67244849 missense noncoding transcript
R8251:Jmjd1c UTSW 10 67239289 missense noncoding transcript
RF011:Jmjd1c UTSW 10 67220199 missense possibly damaging 0.47
Z1088:Jmjd1c UTSW 10 67238174 missense probably benign
Z1176:Jmjd1c UTSW 10 67238174 missense probably benign
Z1177:Jmjd1c UTSW 10 67238174 missense probably benign
Z1177:Jmjd1c UTSW 10 67246125 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACAGAGCTTCGTTGCTTTTAAAAGG -3'
(R):5'- CTTTTCAAAGGATCACTTGTGAGG -3'

Sequencing Primer
(F):5'- GCTTCGTTGCTTTTAAAAGGTAATTC -3'
(R):5'- AAGGATCACTTGTGAGGCTGGG -3'
Posted On2019-11-26