Incidental Mutation 'R7745:Nedd1'
ID596805
Institutional Source Beutler Lab
Gene Symbol Nedd1
Ensembl Gene ENSMUSG00000019988
Gene Nameneural precursor cell expressed, developmentally down-regulated gene 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.955) question?
Stock #R7745 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location92684746-92722420 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 92714172 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 84 (D84N)
Ref Sequence ENSEMBL: ENSMUSP00000020163 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020163] [ENSMUST00000216086]
Predicted Effect probably benign
Transcript: ENSMUST00000020163
AA Change: D84N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000020163
Gene: ENSMUSG00000019988
AA Change: D84N

DomainStartEndE-ValueType
WD40 21 63 5.97e-1 SMART
WD40 67 105 9.75e-3 SMART
WD40 108 147 6.19e-5 SMART
WD40 149 191 6.42e-1 SMART
WD40 194 235 9.1e-3 SMART
WD40 238 276 2.24e-2 SMART
low complexity region 555 568 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000216086
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 96% (55/57)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadac A C 3: 60,038,472 S188R probably damaging Het
Aars T A 8: 111,041,657 I220N probably damaging Het
Abca15 A G 7: 120,332,217 N16S probably damaging Het
Adck1 A T 12: 88,456,800 M358L probably benign Het
Adck5 A T 15: 76,594,548 Q345L probably benign Het
Adgrl2 A G 3: 148,836,458 F876S probably damaging Het
Aebp2 T A 6: 140,623,858 L55Q unknown Het
Ampd2 C A 3: 108,080,116 V134L probably benign Het
Aox3 T C 1: 58,176,517 V1036A possibly damaging Het
Aox4 A G 1: 58,240,707 D494G probably benign Het
Cacna1a C A 8: 84,559,394 H889Q probably benign Het
Cacna1c T C 6: 119,052,626 D151G Het
Car8 A G 4: 8,237,939 V92A possibly damaging Het
Ccdc8 G T 7: 16,995,689 A368S unknown Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Cfap57 C T 4: 118,614,931 V84I probably benign Het
Cntnap5a A G 1: 116,442,283 I877V probably benign Het
Copa A T 1: 172,111,942 D582V probably damaging Het
Cpne2 T G 8: 94,568,684 S466A probably damaging Het
Crybg2 A G 4: 134,088,845 K1311R possibly damaging Het
Csmd1 A G 8: 15,932,461 probably null Het
Dnah2 A T 11: 69,451,318 C2947* probably null Het
Exoc1 A T 5: 76,561,512 K656* probably null Het
Exoc8 T C 8: 124,895,819 N603S probably benign Het
Fam171a1 T A 2: 3,225,446 C539S possibly damaging Het
Fastkd5 A T 2: 130,615,068 I534K probably damaging Het
Fbn1 T C 2: 125,303,195 D2708G probably benign Het
Fhad1 A G 4: 141,890,939 L1392P probably benign Het
Fras1 A T 5: 96,726,895 T2306S probably benign Het
Gdf7 G T 12: 8,301,854 A27E unknown Het
Hnrnph1 A T 11: 50,379,497 I43F probably damaging Het
Igkv8-27 T A 6: 70,172,015 S52C probably benign Het
Jmjd1c T C 10: 67,217,045 F24L probably damaging Het
Knl1 T G 2: 119,071,556 L1246R probably benign Het
Limk2 C T 11: 3,355,896 S191N probably damaging Het
Mdga2 G A 12: 66,689,350 A368V probably damaging Het
Mdga2 C A 12: 66,689,351 A368S possibly damaging Het
Med24 A T 11: 98,704,967 L966Q probably damaging Het
Mgll T C 6: 88,725,788 V23A possibly damaging Het
Obscn A C 11: 59,060,855 L4024R probably damaging Het
Olfr172 A T 16: 58,760,419 Y252* probably null Het
Pcnx2 T C 8: 125,851,107 I944V probably benign Het
Pecr T C 1: 72,266,998 probably null Het
Phf3 A T 1: 30,804,224 W1885R probably damaging Het
Pitpnm2 C G 5: 124,128,705 A697P probably benign Het
Piwil2 T A 14: 70,394,189 H602L probably benign Het
Pprc1 T C 19: 46,065,342 S1104P unknown Het
Prkar1a T A 11: 109,653,847 Y21* probably null Het
Prl2c3 A T 13: 12,798,297 Y9* probably null Het
Rhbdl3 T A 11: 80,323,579 L172Q possibly damaging Het
Rsph3a T G 17: 7,979,243 L484W probably damaging Het
Sbno1 A T 5: 124,392,899 S809T probably benign Het
Stmnd1 T A 13: 46,299,601 V251E possibly damaging Het
Stt3a A T 9: 36,751,239 C241* probably null Het
Tas2r114 A T 6: 131,689,438 M209K probably damaging Het
Tchh G T 3: 93,444,777 R508L unknown Het
Tgfbr3l T C 8: 4,250,622 S267P possibly damaging Het
Ttn T A 2: 76,767,800 I19590F probably damaging Het
Vmn1r171 A G 7: 23,632,610 T87A probably benign Het
Other mutations in Nedd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00764:Nedd1 APN 10 92694974 splice site probably benign
IGL00988:Nedd1 APN 10 92689686 missense possibly damaging 0.71
IGL01563:Nedd1 APN 10 92698169 critical splice donor site probably null
IGL01588:Nedd1 APN 10 92686262 missense probably benign 0.12
IGL01988:Nedd1 APN 10 92714159 missense probably benign 0.39
IGL02706:Nedd1 APN 10 92686285 missense possibly damaging 0.88
IGL02938:Nedd1 APN 10 92689657 nonsense probably null
IGL03011:Nedd1 APN 10 92689641 missense possibly damaging 0.92
Brainless UTSW 10 92690773 missense probably benign 0.01
R0125:Nedd1 UTSW 10 92691929 missense possibly damaging 0.93
R0173:Nedd1 UTSW 10 92698883 missense probably benign 0.30
R0244:Nedd1 UTSW 10 92716265 intron probably benign
R0645:Nedd1 UTSW 10 92691831 splice site probably null
R0791:Nedd1 UTSW 10 92719614 missense probably damaging 1.00
R1490:Nedd1 UTSW 10 92700798 missense probably damaging 1.00
R1522:Nedd1 UTSW 10 92719614 missense probably damaging 1.00
R1797:Nedd1 UTSW 10 92698739 missense possibly damaging 0.46
R1984:Nedd1 UTSW 10 92714160 missense possibly damaging 0.63
R2474:Nedd1 UTSW 10 92719603 missense probably damaging 0.99
R2877:Nedd1 UTSW 10 92714126 missense possibly damaging 0.89
R2883:Nedd1 UTSW 10 92694998 missense probably damaging 0.98
R4694:Nedd1 UTSW 10 92719582 missense probably benign 0.00
R4798:Nedd1 UTSW 10 92698910 missense probably benign 0.00
R4830:Nedd1 UTSW 10 92686258 missense probably damaging 1.00
R4963:Nedd1 UTSW 10 92695031 missense probably damaging 1.00
R5174:Nedd1 UTSW 10 92711212 missense possibly damaging 0.77
R5329:Nedd1 UTSW 10 92686240 missense probably damaging 1.00
R5404:Nedd1 UTSW 10 92716192 missense probably benign 0.04
R5534:Nedd1 UTSW 10 92695032 missense probably benign 0.01
R6045:Nedd1 UTSW 10 92695100 nonsense probably null
R6154:Nedd1 UTSW 10 92698242 missense possibly damaging 0.65
R6512:Nedd1 UTSW 10 92691875 missense probably benign
R6692:Nedd1 UTSW 10 92698337 missense possibly damaging 0.88
R6693:Nedd1 UTSW 10 92698337 missense possibly damaging 0.88
R6943:Nedd1 UTSW 10 92711306 missense probably damaging 1.00
R7011:Nedd1 UTSW 10 92690773 missense probably benign 0.01
R7406:Nedd1 UTSW 10 92711323 splice site probably null
R7455:Nedd1 UTSW 10 92700925 missense probably benign 0.01
R7587:Nedd1 UTSW 10 92698730 missense probably benign 0.01
R8104:Nedd1 UTSW 10 92691916 missense probably damaging 1.00
R8209:Nedd1 UTSW 10 92691935 missense probably benign
R8226:Nedd1 UTSW 10 92691935 missense probably benign
Predicted Primers PCR Primer
(F):5'- CACTTTGACGCTAAAGCATCC -3'
(R):5'- TTATACCTGTGACAGCTGGC -3'

Sequencing Primer
(F):5'- CATCCAATATCGAGGACAAGGTTTG -3'
(R):5'- CTGTGACAGCTGGCATCCAATATATC -3'
Posted On2019-11-26