Incidental Mutation 'R7745:Limk2'
ID596806
Institutional Source Beutler Lab
Gene Symbol Limk2
Ensembl Gene ENSMUSG00000020451
Gene NameLIM motif-containing protein kinase 2
SynonymsLimk2a, A930024P04Rik, LIM kinase 2, Limk2b
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.138) question?
Stock #R7745 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location3344256-3409189 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 3355896 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 191 (S191N)
Ref Sequence ENSEMBL: ENSMUSP00000099162 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101638] [ENSMUST00000101640] [ENSMUST00000101642] [ENSMUST00000110029]
PDB Structure
Solution structure of the PDZ domain from mouse LIM domain kinase [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000101638
AA Change: S191N

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000099162
Gene: ENSMUSG00000020451
AA Change: S191N

DomainStartEndE-ValueType
LIM 11 63 2e-14 SMART
LIM 71 124 4.63e-10 SMART
PDZ 161 239 7.04e-10 SMART
low complexity region 241 255 N/A INTRINSIC
low complexity region 280 306 N/A INTRINSIC
low complexity region 310 322 N/A INTRINSIC
Pfam:Pkinase 331 600 5.3e-48 PFAM
Pfam:Pkinase_Tyr 331 601 4.7e-50 PFAM
Pfam:Kdo 341 497 8.6e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000101640
AA Change: S170N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099163
Gene: ENSMUSG00000020451
AA Change: S170N

DomainStartEndE-ValueType
LIM 7 42 4.91e-1 SMART
LIM 50 103 4.63e-10 SMART
PDZ 140 218 7.04e-10 SMART
low complexity region 220 234 N/A INTRINSIC
low complexity region 259 285 N/A INTRINSIC
low complexity region 289 301 N/A INTRINSIC
Pfam:Pkinase 310 582 1.2e-45 PFAM
Pfam:Pkinase_Tyr 310 586 1.3e-51 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000101642
AA Change: S170N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099165
Gene: ENSMUSG00000020451
AA Change: S170N

DomainStartEndE-ValueType
LIM 7 42 4.91e-1 SMART
LIM 50 103 4.63e-10 SMART
PDZ 140 218 7.04e-10 SMART
low complexity region 220 234 N/A INTRINSIC
low complexity region 259 285 N/A INTRINSIC
low complexity region 289 301 N/A INTRINSIC
Pfam:Pkinase 310 579 4.9e-48 PFAM
Pfam:Pkinase_Tyr 310 580 4.3e-50 PFAM
Pfam:Kdo 320 476 8.2e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110029
AA Change: S4N

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000105656
Gene: ENSMUSG00000020451
AA Change: S4N

DomainStartEndE-ValueType
PDZ 1 52 4.55e-1 SMART
low complexity region 54 68 N/A INTRINSIC
low complexity region 93 119 N/A INTRINSIC
low complexity region 123 135 N/A INTRINSIC
Pfam:Pkinase 144 411 2.7e-49 PFAM
Pfam:Pkinase_Tyr 144 414 1.7e-51 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 96% (55/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] There are approximately 40 known eukaryotic LIM proteins, so named for the LIM domains they contain. LIM domains are highly conserved cysteine-rich structures containing 2 zinc fingers. Although zinc fingers usually function by binding to DNA or RNA, the LIM motif probably mediates protein-protein interactions. LIM kinase-1 and LIM kinase-2 belong to a small subfamily with a unique combination of 2 N-terminal LIM motifs and a C-terminal protein kinase domain. The protein encoded by this gene is phosphorylated and activated by ROCK, a downstream effector of Rho, and the encoded protein, in turn, phosphorylates cofilin, inhibiting its actin-depolymerizing activity. It is thought that this pathway contributes to Rho-induced reorganization of the actin cytoskeleton. At least three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Male homozygotes for targeted null mutations exhibit small testes but are fertile. Mutant kidneys have fewer glomeruli and dilated renal tubules, but function normally. Mice homozygous for a gene trap allele or spontaneous mutation have open eyelids at birth, corneal abnormalities and inflammation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadac A C 3: 60,038,472 S188R probably damaging Het
Aars T A 8: 111,041,657 I220N probably damaging Het
Abca15 A G 7: 120,332,217 N16S probably damaging Het
Adck1 A T 12: 88,456,800 M358L probably benign Het
Adck5 A T 15: 76,594,548 Q345L probably benign Het
Adgrl2 A G 3: 148,836,458 F876S probably damaging Het
Aebp2 T A 6: 140,623,858 L55Q unknown Het
Ampd2 C A 3: 108,080,116 V134L probably benign Het
Aox3 T C 1: 58,176,517 V1036A possibly damaging Het
Aox4 A G 1: 58,240,707 D494G probably benign Het
Cacna1a C A 8: 84,559,394 H889Q probably benign Het
Cacna1c T C 6: 119,052,626 D151G Het
Car8 A G 4: 8,237,939 V92A possibly damaging Het
Ccdc8 G T 7: 16,995,689 A368S unknown Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Cfap57 C T 4: 118,614,931 V84I probably benign Het
Cntnap5a A G 1: 116,442,283 I877V probably benign Het
Copa A T 1: 172,111,942 D582V probably damaging Het
Cpne2 T G 8: 94,568,684 S466A probably damaging Het
Crybg2 A G 4: 134,088,845 K1311R possibly damaging Het
Csmd1 A G 8: 15,932,461 probably null Het
Dnah2 A T 11: 69,451,318 C2947* probably null Het
Exoc1 A T 5: 76,561,512 K656* probably null Het
Exoc8 T C 8: 124,895,819 N603S probably benign Het
Fam171a1 T A 2: 3,225,446 C539S possibly damaging Het
Fastkd5 A T 2: 130,615,068 I534K probably damaging Het
Fbn1 T C 2: 125,303,195 D2708G probably benign Het
Fhad1 A G 4: 141,890,939 L1392P probably benign Het
Fras1 A T 5: 96,726,895 T2306S probably benign Het
Gdf7 G T 12: 8,301,854 A27E unknown Het
Hnrnph1 A T 11: 50,379,497 I43F probably damaging Het
Igkv8-27 T A 6: 70,172,015 S52C probably benign Het
Jmjd1c T C 10: 67,217,045 F24L probably damaging Het
Knl1 T G 2: 119,071,556 L1246R probably benign Het
Mdga2 G A 12: 66,689,350 A368V probably damaging Het
Mdga2 C A 12: 66,689,351 A368S possibly damaging Het
Med24 A T 11: 98,704,967 L966Q probably damaging Het
Mgll T C 6: 88,725,788 V23A possibly damaging Het
Nedd1 C T 10: 92,714,172 D84N probably benign Het
Obscn A C 11: 59,060,855 L4024R probably damaging Het
Olfr172 A T 16: 58,760,419 Y252* probably null Het
Pcnx2 T C 8: 125,851,107 I944V probably benign Het
Pecr T C 1: 72,266,998 probably null Het
Phf3 A T 1: 30,804,224 W1885R probably damaging Het
Pitpnm2 C G 5: 124,128,705 A697P probably benign Het
Piwil2 T A 14: 70,394,189 H602L probably benign Het
Pprc1 T C 19: 46,065,342 S1104P unknown Het
Prkar1a T A 11: 109,653,847 Y21* probably null Het
Prl2c3 A T 13: 12,798,297 Y9* probably null Het
Rhbdl3 T A 11: 80,323,579 L172Q possibly damaging Het
Rsph3a T G 17: 7,979,243 L484W probably damaging Het
Sbno1 A T 5: 124,392,899 S809T probably benign Het
Stmnd1 T A 13: 46,299,601 V251E possibly damaging Het
Stt3a A T 9: 36,751,239 C241* probably null Het
Tas2r114 A T 6: 131,689,438 M209K probably damaging Het
Tchh G T 3: 93,444,777 R508L unknown Het
Tgfbr3l T C 8: 4,250,622 S267P possibly damaging Het
Ttn T A 2: 76,767,800 I19590F probably damaging Het
Vmn1r171 A G 7: 23,632,610 T87A probably benign Het
Other mutations in Limk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01105:Limk2 APN 11 3355475 splice site probably benign
IGL01592:Limk2 APN 11 3359052 missense probably benign 0.00
IGL01716:Limk2 APN 11 3358990 splice site probably null
IGL01911:Limk2 APN 11 3355340 missense probably benign
R0900:Limk2 UTSW 11 3350731 missense probably damaging 1.00
R1587:Limk2 UTSW 11 3353455 missense possibly damaging 0.82
R1632:Limk2 UTSW 11 3346250 missense probably damaging 1.00
R1695:Limk2 UTSW 11 3353275 critical splice donor site probably null
R1712:Limk2 UTSW 11 3358104 splice site probably null
R1792:Limk2 UTSW 11 3358236 missense probably benign
R1982:Limk2 UTSW 11 3355461 missense probably benign 0.00
R3009:Limk2 UTSW 11 3359046 missense probably benign 0.01
R4565:Limk2 UTSW 11 3348634 missense probably damaging 0.98
R4703:Limk2 UTSW 11 3347586 nonsense probably null
R4978:Limk2 UTSW 11 3409069 utr 5 prime probably benign
R5160:Limk2 UTSW 11 3350772 missense probably damaging 1.00
R5460:Limk2 UTSW 11 3352332 missense probably benign 0.30
R6497:Limk2 UTSW 11 3360492 missense probably benign 0.00
R6543:Limk2 UTSW 11 3350682 missense probably damaging 1.00
R6666:Limk2 UTSW 11 3360493 missense probably damaging 1.00
R7054:Limk2 UTSW 11 3355448 missense possibly damaging 0.95
R7330:Limk2 UTSW 11 3346311 missense probably benign 0.39
R7681:Limk2 UTSW 11 3353354 missense probably damaging 0.96
R7722:Limk2 UTSW 11 3356092 splice site probably null
R8120:Limk2 UTSW 11 3348589 splice site probably null
R8193:Limk2 UTSW 11 3347691 missense possibly damaging 0.79
R8379:Limk2 UTSW 11 3371162 start gained probably benign
Predicted Primers PCR Primer
(F):5'- ACAGGCTCAGTGCTAAGATTGG -3'
(R):5'- GTAGATCAGTGACAGTGCCC -3'

Sequencing Primer
(F):5'- TTGGCTGGTTATGGGAAAAACG -3'
(R):5'- CTTCCCTGAGAGGAAGCATTCTG -3'
Posted On2019-11-26