Incidental Mutation 'R7745:Prkar1a'
ID596812
Institutional Source Beutler Lab
Gene Symbol Prkar1a
Ensembl Gene ENSMUSG00000020612
Gene Nameprotein kinase, cAMP dependent regulatory, type I, alpha
SynonymsTse1, Tse-1, 1300018C22Rik, RIalpha
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7745 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location109649405-109669656 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 109653847 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 21 (Y21*)
Ref Sequence ENSEMBL: ENSMUSP00000056500 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049527] [ENSMUST00000106676] [ENSMUST00000106677]
Predicted Effect probably null
Transcript: ENSMUST00000049527
AA Change: Y21*
SMART Domains Protein: ENSMUSP00000056500
Gene: ENSMUSG00000020612
AA Change: Y21*

DomainStartEndE-ValueType
low complexity region 9 20 N/A INTRINSIC
RIIa 25 62 7.54e-15 SMART
cNMP 137 253 2.99e-32 SMART
cNMP 255 374 1.74e-33 SMART
Predicted Effect probably null
Transcript: ENSMUST00000106676
AA Change: Y21*
SMART Domains Protein: ENSMUSP00000102287
Gene: ENSMUSG00000020612
AA Change: Y21*

DomainStartEndE-ValueType
low complexity region 9 20 N/A INTRINSIC
RIIa 25 62 7.54e-15 SMART
SCOP:d1cx4a1 115 168 8e-9 SMART
Blast:cNMP 137 168 6e-15 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000106677
AA Change: Y21*
SMART Domains Protein: ENSMUSP00000102288
Gene: ENSMUSG00000020612
AA Change: Y21*

DomainStartEndE-ValueType
low complexity region 9 20 N/A INTRINSIC
RIIa 25 62 7.54e-15 SMART
cNMP 137 253 2.99e-32 SMART
cNMP 255 374 1.74e-33 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 96% (55/57)
MGI Phenotype FUNCTION: The encoded protein is a regulatory subunit of the cAMP-dependent protein kinase (PKA) complex, which is responsible for transducing most of the cAMP signals in eukaryotic cells. The inactive PKA complex contains two regulatory and two catalytic subunits. Binding of cAMP dissociates the complex, allowing monomeric catalytic subunits to phosphorylate cytosolic proteins or induce gene expression in the nucleus. Several transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality during organogenesis due to developmental patterning defects. Mice heterozygous for a null allele exhibit background sensitive infertility and increased tumor incidence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadac A C 3: 60,038,472 S188R probably damaging Het
Aars T A 8: 111,041,657 I220N probably damaging Het
Abca15 A G 7: 120,332,217 N16S probably damaging Het
Adck1 A T 12: 88,456,800 M358L probably benign Het
Adck5 A T 15: 76,594,548 Q345L probably benign Het
Adgrl2 A G 3: 148,836,458 F876S probably damaging Het
Aebp2 T A 6: 140,623,858 L55Q unknown Het
Ampd2 C A 3: 108,080,116 V134L probably benign Het
Aox3 T C 1: 58,176,517 V1036A possibly damaging Het
Aox4 A G 1: 58,240,707 D494G probably benign Het
Cacna1a C A 8: 84,559,394 H889Q probably benign Het
Cacna1c T C 6: 119,052,626 D151G Het
Car8 A G 4: 8,237,939 V92A possibly damaging Het
Ccdc8 G T 7: 16,995,689 A368S unknown Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Cfap57 C T 4: 118,614,931 V84I probably benign Het
Cntnap5a A G 1: 116,442,283 I877V probably benign Het
Copa A T 1: 172,111,942 D582V probably damaging Het
Cpne2 T G 8: 94,568,684 S466A probably damaging Het
Crybg2 A G 4: 134,088,845 K1311R possibly damaging Het
Csmd1 A G 8: 15,932,461 probably null Het
Dnah2 A T 11: 69,451,318 C2947* probably null Het
Exoc1 A T 5: 76,561,512 K656* probably null Het
Exoc8 T C 8: 124,895,819 N603S probably benign Het
Fam171a1 T A 2: 3,225,446 C539S possibly damaging Het
Fastkd5 A T 2: 130,615,068 I534K probably damaging Het
Fbn1 T C 2: 125,303,195 D2708G probably benign Het
Fhad1 A G 4: 141,890,939 L1392P probably benign Het
Fras1 A T 5: 96,726,895 T2306S probably benign Het
Gdf7 G T 12: 8,301,854 A27E unknown Het
Hnrnph1 A T 11: 50,379,497 I43F probably damaging Het
Igkv8-27 T A 6: 70,172,015 S52C probably benign Het
Jmjd1c T C 10: 67,217,045 F24L probably damaging Het
Knl1 T G 2: 119,071,556 L1246R probably benign Het
Limk2 C T 11: 3,355,896 S191N probably damaging Het
Mdga2 C A 12: 66,689,351 A368S possibly damaging Het
Mdga2 G A 12: 66,689,350 A368V probably damaging Het
Med24 A T 11: 98,704,967 L966Q probably damaging Het
Mgll T C 6: 88,725,788 V23A possibly damaging Het
Nedd1 C T 10: 92,714,172 D84N probably benign Het
Obscn A C 11: 59,060,855 L4024R probably damaging Het
Olfr172 A T 16: 58,760,419 Y252* probably null Het
Pcnx2 T C 8: 125,851,107 I944V probably benign Het
Pecr T C 1: 72,266,998 probably null Het
Phf3 A T 1: 30,804,224 W1885R probably damaging Het
Pitpnm2 C G 5: 124,128,705 A697P probably benign Het
Piwil2 T A 14: 70,394,189 H602L probably benign Het
Pprc1 T C 19: 46,065,342 S1104P unknown Het
Prl2c3 A T 13: 12,798,297 Y9* probably null Het
Rhbdl3 T A 11: 80,323,579 L172Q possibly damaging Het
Rsph3a T G 17: 7,979,243 L484W probably damaging Het
Sbno1 A T 5: 124,392,899 S809T probably benign Het
Stmnd1 T A 13: 46,299,601 V251E possibly damaging Het
Stt3a A T 9: 36,751,239 C241* probably null Het
Tas2r114 A T 6: 131,689,438 M209K probably damaging Het
Tchh G T 3: 93,444,777 R508L unknown Het
Tgfbr3l T C 8: 4,250,622 S267P possibly damaging Het
Ttn T A 2: 76,767,800 I19590F probably damaging Het
Vmn1r171 A G 7: 23,632,610 T87A probably benign Het
Other mutations in Prkar1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00971:Prkar1a APN 11 109661051 missense probably benign 0.25
IGL02108:Prkar1a APN 11 109667525 missense probably damaging 1.00
IGL02227:Prkar1a APN 11 109660175 splice site probably benign
IGL03008:Prkar1a APN 11 109653864 missense probably damaging 0.99
R3900:Prkar1a UTSW 11 109661075 missense probably benign 0.29
R5454:Prkar1a UTSW 11 109660060 missense probably benign 0.01
Z1176:Prkar1a UTSW 11 109660013 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAAATGTTTGAATCTGCTGTCTCG -3'
(R):5'- TGCTTGACTTACTTGGCCAG -3'

Sequencing Primer
(F):5'- CGTGAATTTAAGTAAGTCCCAGGCC -3'
(R):5'- CAGTTGACATTCAGAAGCTCTAAGC -3'
Posted On2019-11-26