Incidental Mutation 'R7745:Adck5'
ID596819
Institutional Source Beutler Lab
Gene Symbol Adck5
Ensembl Gene ENSMUSG00000022550
Gene NameaarF domain containing kinase 5
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7745 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location76576358-76595816 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 76594548 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 345 (Q345L)
Ref Sequence ENSEMBL: ENSMUSP00000125055 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071898] [ENSMUST00000160784] [ENSMUST00000161612] [ENSMUST00000161732] [ENSMUST00000162503] [ENSMUST00000230157] [ENSMUST00000231042]
Predicted Effect probably benign
Transcript: ENSMUST00000071898
SMART Domains Protein: ENSMUSP00000071794
Gene: ENSMUSG00000034022

DomainStartEndE-ValueType
Pfam:MMS1_N 92 684 7.2e-42 PFAM
low complexity region 902 910 N/A INTRINSIC
Pfam:CPSF_A 1071 1407 4.9e-94 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000160784
AA Change: Q345L

PolyPhen 2 Score 0.508 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000124666
Gene: ENSMUSG00000022550
AA Change: Q345L

DomainStartEndE-ValueType
transmembrane domain 50 69 N/A INTRINSIC
Pfam:ABC1 188 304 9.2e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161612
SMART Domains Protein: ENSMUSP00000124701
Gene: ENSMUSG00000022550

DomainStartEndE-ValueType
transmembrane domain 50 69 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161732
SMART Domains Protein: ENSMUSP00000125482
Gene: ENSMUSG00000022550

DomainStartEndE-ValueType
transmembrane domain 50 69 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162503
AA Change: Q345L

PolyPhen 2 Score 0.357 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000125055
Gene: ENSMUSG00000022550
AA Change: Q345L

DomainStartEndE-ValueType
transmembrane domain 50 69 N/A INTRINSIC
Pfam:ABC1 188 304 2.3e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000229287
Predicted Effect probably benign
Transcript: ENSMUST00000230157
Predicted Effect probably benign
Transcript: ENSMUST00000231042
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 96% (55/57)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadac A C 3: 60,038,472 S188R probably damaging Het
Aars T A 8: 111,041,657 I220N probably damaging Het
Abca15 A G 7: 120,332,217 N16S probably damaging Het
Adck1 A T 12: 88,456,800 M358L probably benign Het
Adgrl2 A G 3: 148,836,458 F876S probably damaging Het
Aebp2 T A 6: 140,623,858 L55Q unknown Het
Ampd2 C A 3: 108,080,116 V134L probably benign Het
Aox3 T C 1: 58,176,517 V1036A possibly damaging Het
Aox4 A G 1: 58,240,707 D494G probably benign Het
Cacna1a C A 8: 84,559,394 H889Q probably benign Het
Cacna1c T C 6: 119,052,626 D151G Het
Car8 A G 4: 8,237,939 V92A possibly damaging Het
Ccdc8 G T 7: 16,995,689 A368S unknown Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Cfap57 C T 4: 118,614,931 V84I probably benign Het
Cntnap5a A G 1: 116,442,283 I877V probably benign Het
Copa A T 1: 172,111,942 D582V probably damaging Het
Cpne2 T G 8: 94,568,684 S466A probably damaging Het
Crybg2 A G 4: 134,088,845 K1311R possibly damaging Het
Csmd1 A G 8: 15,932,461 probably null Het
Dnah2 A T 11: 69,451,318 C2947* probably null Het
Exoc1 A T 5: 76,561,512 K656* probably null Het
Exoc8 T C 8: 124,895,819 N603S probably benign Het
Fam171a1 T A 2: 3,225,446 C539S possibly damaging Het
Fastkd5 A T 2: 130,615,068 I534K probably damaging Het
Fbn1 T C 2: 125,303,195 D2708G probably benign Het
Fhad1 A G 4: 141,890,939 L1392P probably benign Het
Fras1 A T 5: 96,726,895 T2306S probably benign Het
Gdf7 G T 12: 8,301,854 A27E unknown Het
Hnrnph1 A T 11: 50,379,497 I43F probably damaging Het
Igkv8-27 T A 6: 70,172,015 S52C probably benign Het
Jmjd1c T C 10: 67,217,045 F24L probably damaging Het
Knl1 T G 2: 119,071,556 L1246R probably benign Het
Limk2 C T 11: 3,355,896 S191N probably damaging Het
Mdga2 G A 12: 66,689,350 A368V probably damaging Het
Mdga2 C A 12: 66,689,351 A368S possibly damaging Het
Med24 A T 11: 98,704,967 L966Q probably damaging Het
Mgll T C 6: 88,725,788 V23A possibly damaging Het
Nedd1 C T 10: 92,714,172 D84N probably benign Het
Obscn A C 11: 59,060,855 L4024R probably damaging Het
Olfr172 A T 16: 58,760,419 Y252* probably null Het
Pcnx2 T C 8: 125,851,107 I944V probably benign Het
Pecr T C 1: 72,266,998 probably null Het
Phf3 A T 1: 30,804,224 W1885R probably damaging Het
Pitpnm2 C G 5: 124,128,705 A697P probably benign Het
Piwil2 T A 14: 70,394,189 H602L probably benign Het
Pprc1 T C 19: 46,065,342 S1104P unknown Het
Prkar1a T A 11: 109,653,847 Y21* probably null Het
Prl2c3 A T 13: 12,798,297 Y9* probably null Het
Rhbdl3 T A 11: 80,323,579 L172Q possibly damaging Het
Rsph3a T G 17: 7,979,243 L484W probably damaging Het
Sbno1 A T 5: 124,392,899 S809T probably benign Het
Stmnd1 T A 13: 46,299,601 V251E possibly damaging Het
Stt3a A T 9: 36,751,239 C241* probably null Het
Tas2r114 A T 6: 131,689,438 M209K probably damaging Het
Tchh G T 3: 93,444,777 R508L unknown Het
Tgfbr3l T C 8: 4,250,622 S267P possibly damaging Het
Ttn T A 2: 76,767,800 I19590F probably damaging Het
Vmn1r171 A G 7: 23,632,610 T87A probably benign Het
Other mutations in Adck5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00742:Adck5 APN 15 76589100 missense possibly damaging 0.59
IGL01366:Adck5 APN 15 76595616 makesense probably null
IGL01534:Adck5 APN 15 76594726 missense probably damaging 1.00
IGL02066:Adck5 APN 15 76595206 missense probably damaging 0.96
IGL02615:Adck5 APN 15 76589167 missense possibly damaging 0.69
IGL02746:Adck5 APN 15 76589154 missense probably benign 0.26
R0865:Adck5 UTSW 15 76595643 missense probably damaging 0.98
R0946:Adck5 UTSW 15 76593286 missense possibly damaging 0.82
R3714:Adck5 UTSW 15 76593938 missense probably damaging 1.00
R3945:Adck5 UTSW 15 76595200 missense probably damaging 1.00
R4373:Adck5 UTSW 15 76594335 unclassified probably benign
R4377:Adck5 UTSW 15 76594335 unclassified probably benign
R5343:Adck5 UTSW 15 76595580 missense probably damaging 0.98
R5372:Adck5 UTSW 15 76594507 unclassified probably benign
R5890:Adck5 UTSW 15 76593585 missense probably damaging 1.00
R6151:Adck5 UTSW 15 76594687 missense possibly damaging 0.81
R6277:Adck5 UTSW 15 76593263 missense possibly damaging 0.58
R6530:Adck5 UTSW 15 76593847 missense probably benign 0.00
R7163:Adck5 UTSW 15 76593816 missense probably damaging 1.00
R7427:Adck5 UTSW 15 76594385 missense possibly damaging 0.78
R7447:Adck5 UTSW 15 76595196 missense possibly damaging 0.93
R7685:Adck5 UTSW 15 76595388 nonsense probably null
X0013:Adck5 UTSW 15 76595342 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- GACAGCTGACTTCTGTAATGGC -3'
(R):5'- TCTAAGCTTCAGGAAGAGGGGC -3'

Sequencing Primer
(F):5'- CAGCTGACTTCTGTAATGGCTGTAAG -3'
(R):5'- GGCTTACTTCTCGTCCAGGAAC -3'
Posted On2019-11-26