Mutagenetix > Incidental Mutations

Incidental Mutation 'R0632:Ptprc'

59682

Institutional Source

Beutler Lab

Gene Symbol

Ptprc

Ensembl Gene

ENSMUSG00000026395

Gene Name

protein tyrosine phosphatase, receptor type, C

Synonyms

B220, Ly-5, Lyt-4, CD45, T200

MMRRC Submission

038821-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.268) question?

Stock #

R0632 (G1)

Quality Score

171

Status

Validated

Chromosome

Chromosomal Location

138062861-138175708 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 138073610 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 965 (V965I)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000182283] [ENSMUST00000182755] [ENSMUST00000183301]

Predicted Effect

probably benign
Transcript: ENSMUST00000027645
AA Change: V965I

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000027645
Gene: ENSMUSG00000026395
AA Change: V965I

Domain	Start	End	E-Value	Type
Pfam:PTP_N	5	30	5e-16	PFAM
low complexity region	109	126	N/A	INTRINSIC
low complexity region	168	203	N/A	INTRINSIC
Pfam:CD45	210	267	3.1e-20	PFAM
FN3	372	456	2.28e0	SMART
FN3	472	550	3.48e-1	SMART
transmembrane domain	565	586	N/A	INTRINSIC
PTPc	639	901	7.57e-127	SMART
PTPc	930	1216	1.39e-102	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000112036

SMART Domains

Protein: ENSMUSP00000107667
Gene: ENSMUSG00000026395

Domain	Start	End	E-Value	Type
Pfam:PTP_N	5	30	5.8e-13	PFAM
low complexity region	31	64	N/A	INTRINSIC
Pfam:CD45	70	129	1.8e-24	PFAM
FN3	233	317	2.28e0	SMART
FN3	333	411	3.48e-1	SMART
transmembrane domain	426	447	N/A	INTRINSIC
PTPc	500	762	7.57e-127	SMART
PTPc	791	1077	1.39e-102	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000182283
AA Change: V828I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000138800
Gene: ENSMUSG00000026395
AA Change: V828I

Domain	Start	End	E-Value	Type
Pfam:PTP_N	7	32	4.2e-13	PFAM
low complexity region	33	66	N/A	INTRINSIC
Pfam:CD45	72	131	2.3e-24	PFAM
FN3	235	319	2.28e0	SMART
FN3	335	413	3.48e-1	SMART
transmembrane domain	428	449	N/A	INTRINSIC
PTPc	502	764	7.57e-127	SMART
PTPc	793	1079	1.39e-102	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000182755
AA Change: V804I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000138275
Gene: ENSMUSG00000026395
AA Change: V804I

Domain	Start	End	E-Value	Type
Pfam:PTP_N	7	34	5.5e-13	PFAM
Pfam:CD45	48	107	2.3e-24	PFAM
FN3	211	295	2.28e0	SMART
FN3	311	389	3.48e-1	SMART
transmembrane domain	404	425	N/A	INTRINSIC
PTPc	478	740	7.57e-127	SMART
PTPc	769	1055	1.39e-102	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000183301
AA Change: V967I

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000138350
Gene: ENSMUSG00000026395
AA Change: V967I

Domain	Start	End	E-Value	Type
Pfam:PTP_N	7	33	2.7e-13	PFAM
low complexity region	111	128	N/A	INTRINSIC
low complexity region	170	205	N/A	INTRINSIC
Pfam:CD45	211	270	2.1e-24	PFAM
FN3	374	458	2.28e0	SMART
FN3	474	552	3.48e-1	SMART
transmembrane domain	567	588	N/A	INTRINSIC
PTPc	641	903	7.57e-127	SMART
PTPc	932	1218	1.39e-102	SMART

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.4%
3x: 99.0%
10x: 97.8%
20x: 96.0%

Validation Efficiency

95% (81/85)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitosis, and oncogenic transformation. This PTP contains an extracellular domain, a single transmembrane segment and two tandem intracytoplasmic catalytic domains, and thus is classified as a receptor type PTP. This PTP has been shown to be an essential regulator of T- and B-cell antigen receptor signaling. It functions through either direct interaction with components of the antigen receptor complexes, or by activating various Src family kinases required for the antigen receptor signaling. This PTP also suppresses JAK kinases, and thus functions as a regulator of cytokine receptor signaling. Alternatively spliced transcripts variants of this gene, which encode distinct isoforms, have been reported. [provided by RefSeq, Jun 2012]
PHENOTYPE: Homozygous null mutants have defective T cell, B cell, and NK cell morphology and physiology. Mice carrying an engineered point mutation exhibit lymphoproliferation and autoimmunity that leads to premature death. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5730559C18Rik	T	C	1: 136,227,618	D83G	probably benign	Het
Acaa1a	T	A	9: 119,347,818		probably benign	Het
Adgrg7	T	A	16: 56,742,589	T462S	possibly damaging	Het
Akap6	A	T	12: 52,937,148	N825I	probably damaging	Het
Ankib1	T	A	5: 3,772,529	N59I	probably benign	Het
Anks6	T	C	4: 47,033,167	S633G	possibly damaging	Het
Ap4e1	C	A	2: 127,049,280	Y522*	probably null	Het
Art5	G	A	7: 102,097,957	T205I	probably damaging	Het
Ascc2	T	A	11: 4,649,855	L176H	probably damaging	Het
Atp13a5	T	C	16: 29,298,208	D529G	probably benign	Het
C2cd4a	T	C	9: 67,831,563	E66G	probably benign	Het
C8a	T	C	4: 104,856,492	D147G	probably damaging	Het
Ccdc109b	T	C	3: 129,918,726	M167V	probably benign	Het
Ccdc14	T	C	16: 34,721,649	V532A	possibly damaging	Het
Ccdc88a	T	A	11: 29,482,749		probably benign	Het
Cfap54	C	T	10: 92,885,096	E2543K	unknown	Het
Cldn13	C	T	5: 134,914,747	E195K	probably benign	Het
Cp	A	G	3: 19,971,082	S402G	probably null	Het
Cpa3	T	C	3: 20,225,194	T194A	probably benign	Het
Crygf	C	A	1: 65,927,997	Y93*	probably null	Het
Ctsh	A	G	9: 90,061,582	R87G	possibly damaging	Het
Cyp2t4	A	G	7: 27,158,246	D428G	possibly damaging	Het
Dnah17	C	G	11: 118,067,682		probably benign	Het
Dnah3	A	G	7: 119,967,905	V2366A	probably benign	Het
Dscaml1	A	T	9: 45,732,134	I1284F	probably benign	Het
Dsg1c	T	C	18: 20,272,346		probably benign	Het
Dst	G	T	1: 34,271,413	R4098L	probably damaging	Het
Efhb	A	G	17: 53,413,459		probably benign	Het
Epha7	A	T	4: 28,821,104	I90F	probably damaging	Het
Fam171a2	T	A	11: 102,437,881	D684V	probably damaging	Het
Fan1	A	G	7: 64,363,199	V665A	possibly damaging	Het
Fbn2	A	G	18: 58,037,747	C2191R	probably damaging	Het
Fkbp3	G	A	12: 65,073,918	A2V	probably benign	Het
G6pd2	A	G	5: 61,810,171	N430D	probably benign	Het
Gm13119	G	A	4: 144,363,782	C464Y	probably damaging	Het
Gm13547	T	A	2: 29,761,584	D7E	possibly damaging	Het
Hdac5	A	T	11: 102,205,812	D260E	probably damaging	Het
Hist1h4i	G	T	13: 22,041,027	Y99*	probably null	Het
Hsf2bp	T	C	17: 32,013,346	E142G	probably damaging	Het
Igf1r	C	T	7: 68,165,155	T268I	probably damaging	Het
Kcne3	C	T	7: 100,184,439	R88C	probably damaging	Het
Klk1b9	G	T	7: 43,979,372	G100V	possibly damaging	Het
Kmt2d	G	A	15: 98,853,581		probably benign	Het
Lama1	C	T	17: 67,752,368		probably benign	Het
Lcp2	C	T	11: 34,082,426	P335S	possibly damaging	Het
Lrrk2	T	A	15: 91,796,028	N2047K	probably damaging	Het
Mia2	T	C	12: 59,136,143	L36P	probably damaging	Het
Mmp13	G	A	9: 7,274,032	G169R	probably damaging	Het
Mmp13	A	T	9: 7,282,077	I460F	possibly damaging	Het
Msh4	A	G	3: 153,896,895	I232T	probably damaging	Het
Msra	T	A	14: 64,210,532	M145L	probably benign	Het
Myo7a	A	T	7: 98,112,150		probably benign	Het
Nme8	A	T	13: 19,658,036	N422K	probably damaging	Het
Nol6	A	T	4: 41,121,115	F353I	probably damaging	Het
Nphp3	A	G	9: 104,018,274	K384E	probably damaging	Het
Olfr572	C	T	7: 102,928,604		probably null	Het
Olfr652	A	G	7: 104,564,337	I39V	probably benign	Het
Olfr672	A	G	7: 104,996,703	I67T	probably benign	Het
Phox2b	T	G	5: 67,096,214		probably benign	Het
Plec	A	T	15: 76,173,411	S4131T	probably damaging	Het
Pptc7	G	A	5: 122,313,591		probably benign	Het
Prpf40b	A	G	15: 99,316,289	E810G	probably benign	Het
Pum1	T	A	4: 130,728,104	M180K	probably benign	Het
Ranbp3	T	C	17: 56,702,896		probably benign	Het
Rasgrf2	A	G	13: 91,972,274	S787P	probably benign	Het
Rnf19b	T	A	4: 129,073,551	N294K	probably damaging	Het
Samd3	A	T	10: 26,244,495	H156L	possibly damaging	Het
Serpinb6c	C	T	13: 33,880,031	R347Q	possibly damaging	Het
Slc36a3	A	G	11: 55,125,080	I416T	probably damaging	Het
Slc4a4	T	A	5: 89,129,641	F279Y	probably damaging	Het
Slc6a2	T	A	8: 92,992,801		probably benign	Het
Snrnp40	C	G	4: 130,378,043		probably null	Het
Tab2	A	G	10: 7,919,801	S232P	probably benign	Het
Tacc2	A	T	7: 130,625,595	K1356*	probably null	Het
Tmem87a	A	G	2: 120,359,542	S544P	probably damaging	Het
Trim52	T	A	14: 106,106,967	C20S	probably damaging	Het
Usp38	A	T	8: 81,014,150	V96E	probably benign	Het
Vmn2r59	T	C	7: 42,058,884	Y33C	probably damaging	Het
Vsig10l	T	G	7: 43,464,137	V171G	probably damaging	Het
Zfp957	T	A	14: 79,212,920	I480F	probably damaging	Het

Other mutations in Ptprc

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
lochy	APN	1	138083790	splice site	probably benign
IGL00486:Ptprc	APN	1	138115621	missense	probably damaging	0.97
IGL00771:Ptprc	APN	1	138113677	missense	probably benign	0.00
IGL00833:Ptprc	APN	1	138078492	missense	possibly damaging	0.55
IGL00919:Ptprc	APN	1	138113642	missense	probably damaging	1.00
IGL01020:Ptprc	APN	1	138120173	critical splice acceptor site	probably null	0.00
IGL01024:Ptprc	APN	1	138080912	missense	probably damaging	1.00
IGL01302:Ptprc	APN	1	138099631	missense	possibly damaging	0.82
IGL01548:Ptprc	APN	1	138099481	critical splice donor site	probably null	0.00
IGL01620:Ptprc	APN	1	138068410	missense	possibly damaging	0.88
IGL01775:Ptprc	APN	1	138064759	missense	probably damaging	1.00
IGL01820:Ptprc	APN	1	138066198	missense	probably damaging	1.00
IGL02340:Ptprc	APN	1	138071219	missense	probably damaging	1.00
IGL02943:Ptprc	APN	1	138099513	missense	probably damaging	0.99
IGL03169:Ptprc	APN	1	138113619	missense	probably benign	0.15
IGL03308:Ptprc	APN	1	138126320	missense	possibly damaging	0.70
IGL03404:Ptprc	APN	1	138093001	missense	probably damaging	1.00
belittle	UTSW	1	138137493	intron	probably benign
bletchley	UTSW	1	138117862	missense	probably benign
Blush	UTSW	1	138117720	intron	probably benign
bruise	UTSW	1	138064771	missense	probably damaging	1.00
chor_muang	UTSW	1	138113562	critical splice donor site	probably null
crystal	UTSW	1	138072255	critical splice donor site	probably null
Dumpling	UTSW	1	138067890	missense	probably damaging	1.00
fuchsia	UTSW	1	138101041	critical splice donor site	probably null
Gentian	UTSW	1	138067885	critical splice donor site	probably null
guotie	UTSW	1	138068401	nonsense	probably null
guotie2	UTSW	1	138094299	missense	probably damaging	0.97
Guotie3	UTSW	1	138078451	missense	possibly damaging	0.92
Gyoza	UTSW	1	138083567	missense	probably damaging	1.00
Half_measure	UTSW	1	138071249	missense	probably damaging	0.98
jirisan	UTSW	1	138113678	nonsense	probably null
mauve	UTSW	1	138099685	missense	probably benign
Perverse	UTSW	1	138101044	missense	probably benign	0.02
ultra	UTSW	1	138078445	critical splice donor site	probably null
violaceous	UTSW	1	138083639	missense	possibly damaging	0.77
R0013:Ptprc	UTSW	1	138113559	unclassified	probably null
R0189:Ptprc	UTSW	1	138082715	missense	probably benign	0.10
R0390:Ptprc	UTSW	1	138122575	missense	possibly damaging	0.71
R0504:Ptprc	UTSW	1	138088697	missense	probably damaging	1.00
R0602:Ptprc	UTSW	1	138089485	splice site	probably benign
R0627:Ptprc	UTSW	1	138068320	missense	probably damaging	0.99
R0751:Ptprc	UTSW	1	138092930	missense	probably damaging	1.00
R0839:Ptprc	UTSW	1	138101132	missense	possibly damaging	0.47
R0942:Ptprc	UTSW	1	138068401	nonsense	probably null
R0943:Ptprc	UTSW	1	138111164	missense	probably damaging	0.96
R1159:Ptprc	UTSW	1	138072319	missense	probably damaging	1.00
R1442:Ptprc	UTSW	1	138072312	missense	probably damaging	1.00
R1489:Ptprc	UTSW	1	138120086	missense	possibly damaging	0.91
R1728:Ptprc	UTSW	1	138099676	missense	probably benign	0.05
R1728:Ptprc	UTSW	1	138107823	missense	probably benign	0.22
R1728:Ptprc	UTSW	1	138107824	missense	probably benign	0.04
R1728:Ptprc	UTSW	1	138107837	missense	probably benign	0.09
R1728:Ptprc	UTSW	1	138112254	missense	possibly damaging	0.53
R1729:Ptprc	UTSW	1	138099676	missense	probably benign	0.05
R1729:Ptprc	UTSW	1	138107823	missense	probably benign	0.22
R1729:Ptprc	UTSW	1	138107824	missense	probably benign	0.04
R1729:Ptprc	UTSW	1	138107837	missense	probably benign	0.09
R1729:Ptprc	UTSW	1	138112254	missense	possibly damaging	0.53
R1730:Ptprc	UTSW	1	138099676	missense	probably benign	0.05
R1730:Ptprc	UTSW	1	138107823	missense	probably benign	0.22
R1730:Ptprc	UTSW	1	138107824	missense	probably benign	0.04
R1730:Ptprc	UTSW	1	138107837	missense	probably benign	0.09
R1730:Ptprc	UTSW	1	138112254	missense	possibly damaging	0.53
R1739:Ptprc	UTSW	1	138099676	missense	probably benign	0.05
R1739:Ptprc	UTSW	1	138107823	missense	probably benign	0.22
R1739:Ptprc	UTSW	1	138107824	missense	probably benign	0.04
R1739:Ptprc	UTSW	1	138107837	missense	probably benign	0.09
R1739:Ptprc	UTSW	1	138112254	missense	possibly damaging	0.53
R1762:Ptprc	UTSW	1	138099676	missense	probably benign	0.05
R1762:Ptprc	UTSW	1	138107823	missense	probably benign	0.22
R1762:Ptprc	UTSW	1	138107824	missense	probably benign	0.04
R1762:Ptprc	UTSW	1	138107837	missense	probably benign	0.09
R1762:Ptprc	UTSW	1	138112254	missense	possibly damaging	0.53
R1783:Ptprc	UTSW	1	138099676	missense	probably benign	0.05
R1783:Ptprc	UTSW	1	138107823	missense	probably benign	0.22
R1783:Ptprc	UTSW	1	138107824	missense	probably benign	0.04
R1783:Ptprc	UTSW	1	138107837	missense	probably benign	0.09
R1783:Ptprc	UTSW	1	138112254	missense	possibly damaging	0.53
R1784:Ptprc	UTSW	1	138099676	missense	probably benign	0.05
R1784:Ptprc	UTSW	1	138107823	missense	probably benign	0.22
R1784:Ptprc	UTSW	1	138107824	missense	probably benign	0.04
R1784:Ptprc	UTSW	1	138107837	missense	probably benign	0.09
R1784:Ptprc	UTSW	1	138112254	missense	possibly damaging	0.53
R1785:Ptprc	UTSW	1	138099676	missense	probably benign	0.05
R1785:Ptprc	UTSW	1	138107823	missense	probably benign	0.22
R1785:Ptprc	UTSW	1	138107824	missense	probably benign	0.04
R1785:Ptprc	UTSW	1	138107837	missense	probably benign	0.09
R1785:Ptprc	UTSW	1	138112254	missense	possibly damaging	0.53
R1862:Ptprc	UTSW	1	138112227	missense	probably benign	0.13
R2145:Ptprc	UTSW	1	138073681	missense	probably damaging	1.00
R2290:Ptprc	UTSW	1	138111188	missense	probably benign	0.00
R2403:Ptprc	UTSW	1	138088532	missense	probably damaging	1.00
R2439:Ptprc	UTSW	1	138066152	missense	possibly damaging	0.67
R2887:Ptprc	UTSW	1	138080178	missense	probably damaging	1.00
R2906:Ptprc	UTSW	1	138064534	missense	possibly damaging	0.93
R3774:Ptprc	UTSW	1	138064773	missense	probably damaging	0.97
R3775:Ptprc	UTSW	1	138064773	missense	probably damaging	0.97
R3776:Ptprc	UTSW	1	138064773	missense	probably damaging	0.97
R3834:Ptprc	UTSW	1	138083567	missense	probably damaging	1.00
R4019:Ptprc	UTSW	1	138078516	missense	probably damaging	1.00
R4377:Ptprc	UTSW	1	138067925	missense	probably benign	0.04
R4580:Ptprc	UTSW	1	138071251	missense	probably benign	0.09
R4923:Ptprc	UTSW	1	138078498	missense	possibly damaging	0.93
R4925:Ptprc	UTSW	1	138099497	missense	probably benign	0.04
R4937:Ptprc	UTSW	1	138089500	missense	probably damaging	1.00
R4970:Ptprc	UTSW	1	138094299	missense	probably damaging	0.97
R5112:Ptprc	UTSW	1	138094299	missense	probably damaging	0.97
R5145:Ptprc	UTSW	1	138089566	missense	probably benign	0.07
R5158:Ptprc	UTSW	1	138175084	missense	possibly damaging	0.75
R5223:Ptprc	UTSW	1	138117862	missense	probably benign
R5593:Ptprc	UTSW	1	138117720	intron	probably benign
R5689:Ptprc	UTSW	1	138117777	missense	probably benign	0.01
R5885:Ptprc	UTSW	1	138088508	missense	probably damaging	1.00
R6010:Ptprc	UTSW	1	138101056	missense	probably benign	0.09
R6026:Ptprc	UTSW	1	138071249	missense	probably damaging	0.98
R6047:Ptprc	UTSW	1	138101041	critical splice donor site	probably null
R6173:Ptprc	UTSW	1	138067890	missense	probably damaging	1.00
R6328:Ptprc	UTSW	1	138113678	nonsense	probably null
R6383:Ptprc	UTSW	1	138078451	missense	possibly damaging	0.92
R6436:Ptprc	UTSW	1	138083639	missense	possibly damaging	0.77
R6492:Ptprc	UTSW	1	138113562	critical splice donor site	probably null
R6520:Ptprc	UTSW	1	138080143	nonsense	probably null
R6805:Ptprc	UTSW	1	138067885	critical splice donor site	probably null
R6830:Ptprc	UTSW	1	138072255	critical splice donor site	probably null
R6847:Ptprc	UTSW	1	138088545	missense	probably damaging	0.99
R6960:Ptprc	UTSW	1	138078445	critical splice donor site	probably null
R6995:Ptprc	UTSW	1	138088744	missense	probably damaging	1.00
R7009:Ptprc	UTSW	1	138064553	missense	probably damaging	0.97
R7041:Ptprc	UTSW	1	138126309	missense	probably benign	0.04
R7055:Ptprc	UTSW	1	138089571	missense	probably damaging	1.00
R7098:Ptprc	UTSW	1	138099685	missense	probably benign
R7164:Ptprc	UTSW	1	138117862	missense	probably benign
R7188:Ptprc	UTSW	1	138071180	missense	probably damaging	1.00
R7191:Ptprc	UTSW	1	138101044	missense	probably benign	0.02
R7204:Ptprc	UTSW	1	138117862	missense	probably benign
R7316:Ptprc	UTSW	1	138064771	missense	probably damaging	1.00
R7644:Ptprc	UTSW	1	138067907	missense	probably benign	0.01
R7948:Ptprc	UTSW	1	138064576	missense	probably benign	0.45
R8029:Ptprc	UTSW	1	138078459	missense	probably damaging	1.00
Z1177:Ptprc	UTSW	1	138067907	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- TGAGGTTGGGGTGGACACACTAAATA -3'
(R):5'- CTGTGGACTCagagactgaactagaagt -3'

Sequencing Primer
(F):5'- tccttccttcctttctttcttcc -3'
(R):5'- gggtgggtgggtggaag -3'

Posted On

2013-07-11