Mutagenetix > Incidental Mutations

Incidental Mutation 'R7746:Garnl3'

596827

Institutional Source

Beutler Lab

Gene Symbol

Garnl3

Ensembl Gene

ENSMUSG00000038860

Gene Name

GTPase activating RANGAP domain-like 3

Synonyms

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.147) question?

Stock #

R7746 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

32986224-33131654 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 32992257 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 822 (D822G)

Ref Sequence

ENSEMBL: ENSMUSP00000122576 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049618] [ENSMUST00000102810] [ENSMUST00000137381]

Predicted Effect

probably damaging
Transcript: ENSMUST00000049618
AA Change: D781G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000057582
Gene: ENSMUSG00000038860
AA Change: D781G

Domain	Start	End	E-Value	Type
Pfam:Rap_GAP	202	383	3.4e-73	PFAM
Pfam:CNH	475	780	3.5e-67	PFAM
low complexity region	793	804	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000102810
AA Change: D777G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000099874
Gene: ENSMUSG00000038860
AA Change: D777G

Domain	Start	End	E-Value	Type
Pfam:Rap_GAP	198	385	4.6e-67	PFAM
Pfam:CNH	471	776	1.8e-68	PFAM
low complexity region	789	800	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000137381
AA Change: D822G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932414N04Rik	A	T	2: 68,728,995	Q184L	probably benign	Het
9030624G23Rik	T	G	12: 24,074,673	S68R	possibly damaging	Het
Acyp1	G	T	12: 85,279,058	R56S	unknown	Het
Angpt2	C	T	8: 18,692,064	R492Q	probably damaging	Het
Ankrd36	T	C	11: 5,687,451	L1340P	possibly damaging	Het
Arhgef33	G	C	17: 80,347,120		probably null	Het
Bach1	G	A	16: 87,729,633	S661N	probably benign	Het
Bik	T	C	15: 83,541,334	I12T	possibly damaging	Het
C3	C	T	17: 57,218,859	R841H	probably damaging	Het
Cacna1s	G	T	1: 136,069,018	R119L	probably damaging	Het
Cic	G	A	7: 25,288,782	V1632M	probably damaging	Het
Ctif	CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC	CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC	18: 75,471,803		probably benign	Het
Dchs2	A	G	3: 83,128,057	H37R	possibly damaging	Het
Dvl1	A	G	4: 155,856,239	I439V	possibly damaging	Het
Fam19a1	T	C	6: 96,115,756		probably null	Het
Fat1	G	A	8: 44,951,633	D474N	probably damaging	Het
Foxs1	T	A	2: 152,933,108	E8D	probably benign	Het
Gm11397	A	T	13: 33,397,858	I133L	probably damaging	Het
Gm11756	C	T	4: 73,919,862	S29N	possibly damaging	Het
Gm44501	C	T	17: 40,578,829	A78V	possibly damaging	Het
Gpr19	C	A	6: 134,869,392	A443S	probably damaging	Het
Helb	T	C	10: 120,095,102	R729G	probably null	Het
Lnpep	G	T	17: 17,538,562	T840K	probably benign	Het
Mctp2	T	C	7: 72,185,796	N551S	probably benign	Het
Mgam	T	G	6: 40,668,193	F635V	probably damaging	Het
Mlc1	G	A	15: 88,964,170	A262V	probably damaging	Het
Muc5b	A	G	7: 141,862,239	Y2974C	probably benign	Het
Nprl3	A	T	11: 32,248,150	Y208*	probably null	Het
Olfr1090	A	T	2: 86,754,093	L215Q	probably damaging	Het
Olfr136	C	T	17: 38,335,394	P79L	probably benign	Het
Pkn2	A	G	3: 142,794,107	F915S	probably damaging	Het
Pkn3	G	A	2: 30,090,584	C829Y	probably benign	Het
Polr1a	C	T	6: 71,941,512	P685S	probably damaging	Het
Ppp4r3b	A	G	11: 29,173,352	D16G	probably benign	Het
Ppwd1	C	T	13: 104,217,206	R348H	probably damaging	Het
Pxdc1	T	C	13: 34,639,063	T98A	probably benign	Het
Rhbdl1	T	C	17: 25,836,193	I68V	probably benign	Het
Ror2	A	G	13: 53,117,225	C365R	probably damaging	Het
Samd4b	A	T	7: 28,403,903	H43Q	probably damaging	Het
Sbf2	A	T	7: 110,441,426	V398D	probably benign	Het
Sbno2	T	C	10: 80,058,874	I1012M	probably damaging	Het
Strn	T	C	17: 78,677,372	T281A	probably benign	Het
Syt4	T	A	18: 31,444,265	D12V	probably benign	Het
Tmem45a	A	G	16: 56,825,737	L40P	probably damaging	Het
Tnn	G	A	1: 160,114,685	P1081L	probably damaging	Het
Unc80	T	C	1: 66,677,385	V2888A	probably benign	Het

Other mutations in Garnl3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01102:Garnl3	APN	2	33006816	missense	probably damaging	1.00
IGL01601:Garnl3	APN	2	32997689	nonsense	probably null
IGL01981:Garnl3	APN	2	32997729	missense	probably damaging	0.98
IGL02209:Garnl3	APN	2	33085930	missense	probably damaging	0.99
IGL02434:Garnl3	APN	2	33054205	missense	probably damaging	1.00
IGL02512:Garnl3	APN	2	33031138	missense	probably damaging	1.00
IGL02947:Garnl3	APN	2	33046594	missense	probably damaging	1.00
PIT4403001:Garnl3	UTSW	2	32990758	missense	probably damaging	1.00
R0123:Garnl3	UTSW	2	33006804	missense	possibly damaging	0.92
R0134:Garnl3	UTSW	2	33006804	missense	possibly damaging	0.92
R0225:Garnl3	UTSW	2	33006804	missense	possibly damaging	0.92
R0551:Garnl3	UTSW	2	33016738	missense	probably damaging	1.00
R0691:Garnl3	UTSW	2	33085907	missense	probably damaging	1.00
R0693:Garnl3	UTSW	2	33085907	missense	probably damaging	1.00
R0737:Garnl3	UTSW	2	32990642	missense	probably damaging	0.98
R1350:Garnl3	UTSW	2	33052214	missense	probably damaging	1.00
R1691:Garnl3	UTSW	2	32997663	nonsense	probably null
R1791:Garnl3	UTSW	2	33034127	missense	probably benign	0.02
R1938:Garnl3	UTSW	2	33005200	missense	probably damaging	0.99
R2100:Garnl3	UTSW	2	33046645	missense	probably benign	0.35
R2316:Garnl3	UTSW	2	33005152	missense	probably damaging	1.00
R2353:Garnl3	UTSW	2	33064034	missense	probably damaging	1.00
R3161:Garnl3	UTSW	2	33034711	missense	probably damaging	1.00
R3839:Garnl3	UTSW	2	32989546	missense	probably benign	0.00
R3847:Garnl3	UTSW	2	32992228	missense	probably benign
R4871:Garnl3	UTSW	2	33087088	start codon destroyed	probably null	0.77
R5682:Garnl3	UTSW	2	33054173	missense	probably damaging	1.00
R5811:Garnl3	UTSW	2	33006899	missense	probably damaging	0.99
R6267:Garnl3	UTSW	2	33104880	missense	probably benign	0.20
R6502:Garnl3	UTSW	2	33006821	missense	possibly damaging	0.67
R6532:Garnl3	UTSW	2	33031119	missense	possibly damaging	0.87
R6639:Garnl3	UTSW	2	32989525	missense	possibly damaging	0.75
R6763:Garnl3	UTSW	2	33054196	missense	probably damaging	1.00
R6866:Garnl3	UTSW	2	33002773	splice site	probably null
R6913:Garnl3	UTSW	2	32986829	missense	possibly damaging	0.91
R7002:Garnl3	UTSW	2	33054193	missense	possibly damaging	0.65
R7168:Garnl3	UTSW	2	32995078	missense	probably damaging	1.00
R7341:Garnl3	UTSW	2	33034129	missense	probably damaging	1.00
X0022:Garnl3	UTSW	2	33022668	missense	probably damaging	1.00
X0023:Garnl3	UTSW	2	33026149	missense	probably damaging	1.00
X0024:Garnl3	UTSW	2	33005179	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- AGGTGTAGCTCTGACAATAACCC -3'
(R):5'- AGACTCCTGAGGGAAGTGTG -3'

Sequencing Primer
(F):5'- TGTAGCTCTGACAATAACCCTAAGAC -3'
(R):5'- ACCTTGGGAAATATGATATGGCTG -3'

Posted On

2019-11-26