Incidental Mutation 'R7746:Foxs1'
ID596830
Institutional Source Beutler Lab
Gene Symbol Foxs1
Ensembl Gene ENSMUSG00000074676
Gene Nameforkhead box S1
SynonymsFkh3, FREAC10, Fkhl18
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.327) question?
Stock #R7746 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location152931898-152933208 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 152933108 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 8 (E8D)
Ref Sequence ENSEMBL: ENSMUSP00000096806 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099200]
Predicted Effect probably benign
Transcript: ENSMUST00000099200
AA Change: E8D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000096806
Gene: ENSMUSG00000074676
AA Change: E8D

DomainStartEndE-ValueType
FH 16 106 1.88e-60 SMART
low complexity region 269 283 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The forkhead family of transcription factors belongs to the winged helix class of DNA-binding proteins. The protein encoded by this intronless gene contains a forkhead domain and is found predominantly in aorta and kidney. The function of the encoded protein is unknown. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for one reporter allele display enhanced rotarod performance and increased male resistance to diet-induced obesity. Homozygotes for another reporter allele show impaired testicular vasculature, including blood accumulation in fetal testis and marked apoptosis of periendothelial cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik A T 2: 68,728,995 Q184L probably benign Het
9030624G23Rik T G 12: 24,074,673 S68R possibly damaging Het
Acyp1 G T 12: 85,279,058 R56S unknown Het
Angpt2 C T 8: 18,692,064 R492Q probably damaging Het
Ankrd36 T C 11: 5,687,451 L1340P possibly damaging Het
Arhgef33 G C 17: 80,347,120 probably null Het
Bach1 G A 16: 87,729,633 S661N probably benign Het
Bik T C 15: 83,541,334 I12T possibly damaging Het
C3 C T 17: 57,218,859 R841H probably damaging Het
Cacna1s G T 1: 136,069,018 R119L probably damaging Het
Cic G A 7: 25,288,782 V1632M probably damaging Het
Ctif CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC 18: 75,471,803 probably benign Het
Dchs2 A G 3: 83,128,057 H37R possibly damaging Het
Dvl1 A G 4: 155,856,239 I439V possibly damaging Het
Fam19a1 T C 6: 96,115,756 probably null Het
Fat1 G A 8: 44,951,633 D474N probably damaging Het
Garnl3 T C 2: 32,992,257 D822G probably damaging Het
Gm11397 A T 13: 33,397,858 I133L probably damaging Het
Gm11756 C T 4: 73,919,862 S29N possibly damaging Het
Gm44501 C T 17: 40,578,829 A78V possibly damaging Het
Gpr19 C A 6: 134,869,392 A443S probably damaging Het
Helb T C 10: 120,095,102 R729G probably null Het
Lnpep G T 17: 17,538,562 T840K probably benign Het
Mctp2 T C 7: 72,185,796 N551S probably benign Het
Mgam T G 6: 40,668,193 F635V probably damaging Het
Mlc1 G A 15: 88,964,170 A262V probably damaging Het
Muc5b A G 7: 141,862,239 Y2974C probably benign Het
Nprl3 A T 11: 32,248,150 Y208* probably null Het
Olfr1090 A T 2: 86,754,093 L215Q probably damaging Het
Olfr136 C T 17: 38,335,394 P79L probably benign Het
Pkn2 A G 3: 142,794,107 F915S probably damaging Het
Pkn3 G A 2: 30,090,584 C829Y probably benign Het
Polr1a C T 6: 71,941,512 P685S probably damaging Het
Ppp4r3b A G 11: 29,173,352 D16G probably benign Het
Ppwd1 C T 13: 104,217,206 R348H probably damaging Het
Pxdc1 T C 13: 34,639,063 T98A probably benign Het
Rhbdl1 T C 17: 25,836,193 I68V probably benign Het
Ror2 A G 13: 53,117,225 C365R probably damaging Het
Samd4b A T 7: 28,403,903 H43Q probably damaging Het
Sbf2 A T 7: 110,441,426 V398D probably benign Het
Sbno2 T C 10: 80,058,874 I1012M probably damaging Het
Strn T C 17: 78,677,372 T281A probably benign Het
Syt4 T A 18: 31,444,265 D12V probably benign Het
Tmem45a A G 16: 56,825,737 L40P probably damaging Het
Tnn G A 1: 160,114,685 P1081L probably damaging Het
Unc80 T C 1: 66,677,385 V2888A probably benign Het
Other mutations in Foxs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01641:Foxs1 APN 2 152932312 missense probably benign
IGL02304:Foxs1 APN 2 152932350 missense probably benign 0.01
IGL02491:Foxs1 APN 2 152932801 missense probably damaging 1.00
IGL03009:Foxs1 APN 2 152932929 missense probably damaging 1.00
IGL03046:Foxs1 UTSW 2 152932564 missense probably benign 0.00
R0158:Foxs1 UTSW 2 152932410 missense probably damaging 1.00
R0324:Foxs1 UTSW 2 152932687 missense probably benign 0.02
R1616:Foxs1 UTSW 2 152932639 missense probably benign 0.37
R1915:Foxs1 UTSW 2 152932840 missense probably damaging 0.99
R3113:Foxs1 UTSW 2 152932236 missense probably benign 0.00
R4885:Foxs1 UTSW 2 152932381 missense probably benign 0.00
R6084:Foxs1 UTSW 2 152932842 missense possibly damaging 0.81
R6265:Foxs1 UTSW 2 152932178 nonsense probably null
R6720:Foxs1 UTSW 2 152932720 missense probably damaging 0.99
R6828:Foxs1 UTSW 2 152933128 nonsense probably null
R6845:Foxs1 UTSW 2 152932699 missense probably benign
R7456:Foxs1 UTSW 2 152933125 missense probably benign
R7577:Foxs1 UTSW 2 152932441 missense probably benign 0.01
R7841:Foxs1 UTSW 2 152932987 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- TTGAGAGACAGGTTATGGCG -3'
(R):5'- GCCTCCTTAGACTTGACAAGG -3'

Sequencing Primer
(F):5'- ACAGGTTATGGCGGATGC -3'
(R):5'- CTTAGACTTGACAAGGGCGGTG -3'
Posted On2019-11-26