Incidental Mutation 'R7746:Gpr19'
ID596838
Institutional Source Beutler Lab
Gene Symbol Gpr19
Ensembl Gene ENSMUSG00000032641
Gene NameG protein-coupled receptor 19
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7746 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location134869093-134898578 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 134869392 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 443 (A443S)
Ref Sequence ENSEMBL: ENSMUSP00000066287 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046255] [ENSMUST00000066107] [ENSMUST00000111932] [ENSMUST00000116515] [ENSMUST00000165392] [ENSMUST00000203409] [ENSMUST00000203762] [ENSMUST00000204880] [ENSMUST00000215088]
Predicted Effect probably damaging
Transcript: ENSMUST00000046255
AA Change: A357S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000047630
Gene: ENSMUSG00000032641
AA Change: A357S

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 76 345 1.7e-12 PFAM
Pfam:7tm_1 82 330 1.8e-50 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000066107
AA Change: A443S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000066287
Gene: ENSMUSG00000032641
AA Change: A443S

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 76 345 1.7e-12 PFAM
Pfam:7tm_1 82 330 5.3e-45 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111932
AA Change: A351S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107563
Gene: ENSMUSG00000032641
AA Change: A351S

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 70 339 2.6e-12 PFAM
Pfam:7tm_1 76 324 3.5e-50 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000116515
AA Change: A351S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112214
Gene: ENSMUSG00000032641
AA Change: A351S

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 70 339 2.6e-12 PFAM
Pfam:7tm_1 76 324 3.5e-50 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000165392
AA Change: A351S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000127876
Gene: ENSMUSG00000032641
AA Change: A351S

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 70 339 2.6e-12 PFAM
Pfam:7tm_1 76 324 3.5e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203409
SMART Domains Protein: ENSMUSP00000145128
Gene: ENSMUSG00000032641

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 70 132 9e-5 PFAM
Pfam:7tm_1 76 135 2.6e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203762
Predicted Effect probably benign
Transcript: ENSMUST00000204880
SMART Domains Protein: ENSMUSP00000144918
Gene: ENSMUSG00000032641

DomainStartEndE-ValueType
transmembrane domain 59 76 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000215088
AA Change: A406S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene results in increased anxiety-like behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik A T 2: 68,728,995 Q184L probably benign Het
9030624G23Rik T G 12: 24,074,673 S68R possibly damaging Het
Acyp1 G T 12: 85,279,058 R56S unknown Het
Angpt2 C T 8: 18,692,064 R492Q probably damaging Het
Ankrd36 T C 11: 5,687,451 L1340P possibly damaging Het
Arhgef33 G C 17: 80,347,120 probably null Het
Bach1 G A 16: 87,729,633 S661N probably benign Het
Bik T C 15: 83,541,334 I12T possibly damaging Het
C3 C T 17: 57,218,859 R841H probably damaging Het
Cacna1s G T 1: 136,069,018 R119L probably damaging Het
Cic G A 7: 25,288,782 V1632M probably damaging Het
Ctif CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC 18: 75,471,803 probably benign Het
Dchs2 A G 3: 83,128,057 H37R possibly damaging Het
Dvl1 A G 4: 155,856,239 I439V possibly damaging Het
Fam19a1 T C 6: 96,115,756 probably null Het
Fat1 G A 8: 44,951,633 D474N probably damaging Het
Foxs1 T A 2: 152,933,108 E8D probably benign Het
Garnl3 T C 2: 32,992,257 D822G probably damaging Het
Gm11397 A T 13: 33,397,858 I133L probably damaging Het
Gm11756 C T 4: 73,919,862 S29N possibly damaging Het
Gm44501 C T 17: 40,578,829 A78V possibly damaging Het
Helb T C 10: 120,095,102 R729G probably null Het
Lnpep G T 17: 17,538,562 T840K probably benign Het
Mctp2 T C 7: 72,185,796 N551S probably benign Het
Mgam T G 6: 40,668,193 F635V probably damaging Het
Mlc1 G A 15: 88,964,170 A262V probably damaging Het
Muc5b A G 7: 141,862,239 Y2974C probably benign Het
Nprl3 A T 11: 32,248,150 Y208* probably null Het
Olfr1090 A T 2: 86,754,093 L215Q probably damaging Het
Olfr136 C T 17: 38,335,394 P79L probably benign Het
Pkn2 A G 3: 142,794,107 F915S probably damaging Het
Pkn3 G A 2: 30,090,584 C829Y probably benign Het
Polr1a C T 6: 71,941,512 P685S probably damaging Het
Ppp4r3b A G 11: 29,173,352 D16G probably benign Het
Ppwd1 C T 13: 104,217,206 R348H probably damaging Het
Pxdc1 T C 13: 34,639,063 T98A probably benign Het
Rhbdl1 T C 17: 25,836,193 I68V probably benign Het
Ror2 A G 13: 53,117,225 C365R probably damaging Het
Samd4b A T 7: 28,403,903 H43Q probably damaging Het
Sbf2 A T 7: 110,441,426 V398D probably benign Het
Sbno2 T C 10: 80,058,874 I1012M probably damaging Het
Strn T C 17: 78,677,372 T281A probably benign Het
Syt4 T A 18: 31,444,265 D12V probably benign Het
Tmem45a A G 16: 56,825,737 L40P probably damaging Het
Tnn G A 1: 160,114,685 P1081L probably damaging Het
Unc80 T C 1: 66,677,385 V2888A probably benign Het
Other mutations in Gpr19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01310:Gpr19 APN 6 134869742 missense probably damaging 0.99
IGL01373:Gpr19 APN 6 134870321 missense possibly damaging 0.81
IGL01988:Gpr19 APN 6 134869284 missense probably damaging 1.00
R1530:Gpr19 UTSW 6 134869998 missense probably damaging 0.97
R1548:Gpr19 UTSW 6 134870084 missense possibly damaging 0.92
R1699:Gpr19 UTSW 6 134870229 missense possibly damaging 0.93
R2131:Gpr19 UTSW 6 134870442 start codon destroyed probably null 0.99
R5016:Gpr19 UTSW 6 134869917 nonsense probably null
R6605:Gpr19 UTSW 6 134870435 missense probably benign 0.02
R7080:Gpr19 UTSW 6 134870456 missense probably damaging 0.99
R8014:Gpr19 UTSW 6 134869473 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCACATAACAGTGAAAGACTTC -3'
(R):5'- ACCTTTCCATGTGGCTCAGC -3'

Sequencing Primer
(F):5'- ACAGTGAAAGACTTCTTAGAAATCAG -3'
(R):5'- ATGTGGCTCAGCTCTGGCATC -3'
Posted On2019-11-26