Incidental Mutation 'R7746:Mctp2'
ID596841
Institutional Source Beutler Lab
Gene Symbol Mctp2
Ensembl Gene ENSMUSG00000032776
Gene Namemultiple C2 domains, transmembrane 2
SynonymsLOC244049
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.172) question?
Stock #R7746 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location72077830-72306608 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 72185796 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 551 (N551S)
Ref Sequence ENSEMBL: ENSMUSP00000078302 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079323]
Predicted Effect probably benign
Transcript: ENSMUST00000079323
AA Change: N551S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000078302
Gene: ENSMUSG00000032776
AA Change: N551S

DomainStartEndE-ValueType
low complexity region 24 35 N/A INTRINSIC
low complexity region 90 103 N/A INTRINSIC
C2 195 291 7.5e-20 SMART
C2 357 451 1.27e-8 SMART
C2 510 606 5.38e-21 SMART
transmembrane domain 696 718 N/A INTRINSIC
Pfam:PRT_C 723 857 2.4e-11 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik A T 2: 68,728,995 Q184L probably benign Het
9030624G23Rik T G 12: 24,074,673 S68R possibly damaging Het
Acyp1 G T 12: 85,279,058 R56S unknown Het
Angpt2 C T 8: 18,692,064 R492Q probably damaging Het
Ankrd36 T C 11: 5,687,451 L1340P possibly damaging Het
Arhgef33 G C 17: 80,347,120 probably null Het
Bach1 G A 16: 87,729,633 S661N probably benign Het
Bik T C 15: 83,541,334 I12T possibly damaging Het
C3 C T 17: 57,218,859 R841H probably damaging Het
Cacna1s G T 1: 136,069,018 R119L probably damaging Het
Cic G A 7: 25,288,782 V1632M probably damaging Het
Ctif CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC 18: 75,471,803 probably benign Het
Dchs2 A G 3: 83,128,057 H37R possibly damaging Het
Dvl1 A G 4: 155,856,239 I439V possibly damaging Het
Fam19a1 T C 6: 96,115,756 probably null Het
Fat1 G A 8: 44,951,633 D474N probably damaging Het
Foxs1 T A 2: 152,933,108 E8D probably benign Het
Garnl3 T C 2: 32,992,257 D822G probably damaging Het
Gm11397 A T 13: 33,397,858 I133L probably damaging Het
Gm11756 C T 4: 73,919,862 S29N possibly damaging Het
Gm44501 C T 17: 40,578,829 A78V possibly damaging Het
Gpr19 C A 6: 134,869,392 A443S probably damaging Het
Helb T C 10: 120,095,102 R729G probably null Het
Lnpep G T 17: 17,538,562 T840K probably benign Het
Mgam T G 6: 40,668,193 F635V probably damaging Het
Mlc1 G A 15: 88,964,170 A262V probably damaging Het
Muc5b A G 7: 141,862,239 Y2974C probably benign Het
Nprl3 A T 11: 32,248,150 Y208* probably null Het
Olfr1090 A T 2: 86,754,093 L215Q probably damaging Het
Olfr136 C T 17: 38,335,394 P79L probably benign Het
Pkn2 A G 3: 142,794,107 F915S probably damaging Het
Pkn3 G A 2: 30,090,584 C829Y probably benign Het
Polr1a C T 6: 71,941,512 P685S probably damaging Het
Ppp4r3b A G 11: 29,173,352 D16G probably benign Het
Ppwd1 C T 13: 104,217,206 R348H probably damaging Het
Pxdc1 T C 13: 34,639,063 T98A probably benign Het
Rhbdl1 T C 17: 25,836,193 I68V probably benign Het
Ror2 A G 13: 53,117,225 C365R probably damaging Het
Samd4b A T 7: 28,403,903 H43Q probably damaging Het
Sbf2 A T 7: 110,441,426 V398D probably benign Het
Sbno2 T C 10: 80,058,874 I1012M probably damaging Het
Strn T C 17: 78,677,372 T281A probably benign Het
Syt4 T A 18: 31,444,265 D12V probably benign Het
Tmem45a A G 16: 56,825,737 L40P probably damaging Het
Tnn G A 1: 160,114,685 P1081L probably damaging Het
Unc80 T C 1: 66,677,385 V2888A probably benign Het
Other mutations in Mctp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01108:Mctp2 APN 7 72185815 missense probably damaging 0.96
IGL01296:Mctp2 APN 7 72228526 missense probably benign 0.03
IGL01509:Mctp2 APN 7 72259269 missense probably benign 0.01
IGL02074:Mctp2 APN 7 72161258 missense probably damaging 0.99
IGL02185:Mctp2 APN 7 72080823 missense probably benign 0.13
IGL02238:Mctp2 APN 7 72090205 nonsense probably null
IGL02707:Mctp2 APN 7 72259341 missense possibly damaging 0.95
IGL02820:Mctp2 APN 7 72245542 missense probably damaging 0.99
IGL02869:Mctp2 APN 7 72228471 critical splice donor site probably null
IGL03354:Mctp2 APN 7 72161244 missense probably benign 0.00
IGL03397:Mctp2 APN 7 72259277 missense probably damaging 0.98
IGL03407:Mctp2 APN 7 72211652 missense probably benign 0.05
F5770:Mctp2 UTSW 7 72121751 splice site probably benign
PIT4131001:Mctp2 UTSW 7 72090257 missense probably damaging 1.00
R0013:Mctp2 UTSW 7 72229408 missense probably benign 0.00
R0079:Mctp2 UTSW 7 72214116 splice site probably benign
R0083:Mctp2 UTSW 7 72228516 missense possibly damaging 0.94
R0173:Mctp2 UTSW 7 72247107 critical splice donor site probably null
R0302:Mctp2 UTSW 7 72090264 missense possibly damaging 0.94
R0533:Mctp2 UTSW 7 72080822 missense probably benign 0.00
R0675:Mctp2 UTSW 7 72083170 missense probably damaging 1.00
R1076:Mctp2 UTSW 7 72185867 critical splice acceptor site probably null
R1222:Mctp2 UTSW 7 72259139 missense probably benign
R1356:Mctp2 UTSW 7 72164723 unclassified probably benign
R1628:Mctp2 UTSW 7 72211589 splice site probably null
R1649:Mctp2 UTSW 7 72161258 missense probably damaging 0.99
R1981:Mctp2 UTSW 7 72164698 missense probably benign 0.01
R2256:Mctp2 UTSW 7 72185820 missense probably damaging 1.00
R2257:Mctp2 UTSW 7 72185820 missense probably damaging 1.00
R2327:Mctp2 UTSW 7 72211610 missense probably damaging 0.99
R2407:Mctp2 UTSW 7 72200407 missense probably benign 0.40
R2471:Mctp2 UTSW 7 72161161 nonsense probably null
R3706:Mctp2 UTSW 7 72214111 splice site probably benign
R4023:Mctp2 UTSW 7 72090239 missense possibly damaging 0.88
R4025:Mctp2 UTSW 7 72090239 missense possibly damaging 0.88
R4176:Mctp2 UTSW 7 72259337 missense probably benign
R4272:Mctp2 UTSW 7 72259331 missense possibly damaging 0.63
R4498:Mctp2 UTSW 7 72183851 missense probably damaging 1.00
R4654:Mctp2 UTSW 7 72090194 missense probably damaging 1.00
R4815:Mctp2 UTSW 7 72259349 missense possibly damaging 0.89
R4946:Mctp2 UTSW 7 72259269 missense probably benign 0.00
R5389:Mctp2 UTSW 7 72214087 missense possibly damaging 0.50
R5682:Mctp2 UTSW 7 72245459 critical splice donor site probably null
R5878:Mctp2 UTSW 7 72214108 missense probably benign 0.01
R5918:Mctp2 UTSW 7 72228540 missense probably damaging 1.00
R5956:Mctp2 UTSW 7 72259175 missense probably benign
R5964:Mctp2 UTSW 7 72103177 missense probably damaging 0.97
R5978:Mctp2 UTSW 7 72090188 missense probably damaging 1.00
R6054:Mctp2 UTSW 7 72259103 missense probably benign
R6475:Mctp2 UTSW 7 72200344 critical splice donor site probably null
R6849:Mctp2 UTSW 7 72211718 missense probably damaging 1.00
R6963:Mctp2 UTSW 7 72228056 missense probably damaging 1.00
R7366:Mctp2 UTSW 7 72259214 missense probably benign 0.00
R7468:Mctp2 UTSW 7 72211690 missense probably damaging 1.00
R7822:Mctp2 UTSW 7 72127187 missense possibly damaging 0.90
X0066:Mctp2 UTSW 7 72259280 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CAGTCCCTTACAGTTCCAAATGG -3'
(R):5'- ATGTGGATCCAGCAAGCCTG -3'

Sequencing Primer
(F):5'- CTTACAGTTCCAAATGGTCTCTTC -3'
(R):5'- GCAAGCCTGCTGAGAGC -3'
Posted On2019-11-26