Incidental Mutation 'R7746:Angpt2'
ID596844
Institutional Source Beutler Lab
Gene Symbol Angpt2
Ensembl Gene ENSMUSG00000031465
Gene Nameangiopoietin 2
SynonymsAng2, Ang-2
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.711) question?
Stock #R7746 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location18690263-18741562 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 18692064 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 492 (R492Q)
Ref Sequence ENSEMBL: ENSMUSP00000033846 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033846] [ENSMUST00000039412] [ENSMUST00000124910]
Predicted Effect probably damaging
Transcript: ENSMUST00000033846
AA Change: R492Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000033846
Gene: ENSMUSG00000031465
AA Change: R492Q

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
coiled coil region 166 248 N/A INTRINSIC
FBG 279 494 9.43e-129 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000039412
SMART Domains Protein: ENSMUSP00000037000
Gene: ENSMUSG00000039842

DomainStartEndE-ValueType
BRCT 13 89 2.64e-4 SMART
coiled coil region 128 155 N/A INTRINSIC
Pfam:Microcephalin 224 597 1.2e-143 PFAM
BRCT 624 707 2.23e-2 SMART
BRCT 740 810 1.55e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124910
SMART Domains Protein: ENSMUSP00000131698
Gene: ENSMUSG00000039842

DomainStartEndE-ValueType
BRCT 13 89 2.64e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes an endothelial cell (EC)-derived regulator of angiogenesis and ligand for endothelial-specific receptor tyrosine kinase. The encoded protein acts as an anti-apoptotic factor for stressed ECs and a proapoptotic factor for resting ECs. [provided by RefSeq, Jan 2013]
PHENOTYPE: Homozygous inactivation of this gene results in impaired angiogenesis, abnormal lymphatic development and function, and ultimately postnatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik A T 2: 68,728,995 Q184L probably benign Het
9030624G23Rik T G 12: 24,074,673 S68R possibly damaging Het
Acyp1 G T 12: 85,279,058 R56S unknown Het
Ankrd36 T C 11: 5,687,451 L1340P possibly damaging Het
Arhgef33 G C 17: 80,347,120 probably null Het
Bach1 G A 16: 87,729,633 S661N probably benign Het
Bik T C 15: 83,541,334 I12T possibly damaging Het
C3 C T 17: 57,218,859 R841H probably damaging Het
Cacna1s G T 1: 136,069,018 R119L probably damaging Het
Cic G A 7: 25,288,782 V1632M probably damaging Het
Ctif CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC 18: 75,471,803 probably benign Het
Dchs2 A G 3: 83,128,057 H37R possibly damaging Het
Dvl1 A G 4: 155,856,239 I439V possibly damaging Het
Fam19a1 T C 6: 96,115,756 probably null Het
Fat1 G A 8: 44,951,633 D474N probably damaging Het
Foxs1 T A 2: 152,933,108 E8D probably benign Het
Garnl3 T C 2: 32,992,257 D822G probably damaging Het
Gm11397 A T 13: 33,397,858 I133L probably damaging Het
Gm11756 C T 4: 73,919,862 S29N possibly damaging Het
Gm44501 C T 17: 40,578,829 A78V possibly damaging Het
Gpr19 C A 6: 134,869,392 A443S probably damaging Het
Helb T C 10: 120,095,102 R729G probably null Het
Lnpep G T 17: 17,538,562 T840K probably benign Het
Mctp2 T C 7: 72,185,796 N551S probably benign Het
Mgam T G 6: 40,668,193 F635V probably damaging Het
Mlc1 G A 15: 88,964,170 A262V probably damaging Het
Muc5b A G 7: 141,862,239 Y2974C probably benign Het
Nprl3 A T 11: 32,248,150 Y208* probably null Het
Olfr1090 A T 2: 86,754,093 L215Q probably damaging Het
Olfr136 C T 17: 38,335,394 P79L probably benign Het
Pkn2 A G 3: 142,794,107 F915S probably damaging Het
Pkn3 G A 2: 30,090,584 C829Y probably benign Het
Polr1a C T 6: 71,941,512 P685S probably damaging Het
Ppp4r3b A G 11: 29,173,352 D16G probably benign Het
Ppwd1 C T 13: 104,217,206 R348H probably damaging Het
Pxdc1 T C 13: 34,639,063 T98A probably benign Het
Rhbdl1 T C 17: 25,836,193 I68V probably benign Het
Ror2 A G 13: 53,117,225 C365R probably damaging Het
Samd4b A T 7: 28,403,903 H43Q probably damaging Het
Sbf2 A T 7: 110,441,426 V398D probably benign Het
Sbno2 T C 10: 80,058,874 I1012M probably damaging Het
Strn T C 17: 78,677,372 T281A probably benign Het
Syt4 T A 18: 31,444,265 D12V probably benign Het
Tmem45a A G 16: 56,825,737 L40P probably damaging Het
Tnn G A 1: 160,114,685 P1081L probably damaging Het
Unc80 T C 1: 66,677,385 V2888A probably benign Het
Other mutations in Angpt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01298:Angpt2 APN 8 18710528 missense probably benign 0.01
IGL01449:Angpt2 APN 8 18710625 missense probably benign 0.01
IGL03088:Angpt2 APN 8 18741023 missense probably benign 0.09
P0037:Angpt2 UTSW 8 18714243 unclassified probably benign
R0308:Angpt2 UTSW 8 18692125 missense possibly damaging 0.93
R1099:Angpt2 UTSW 8 18699133 missense probably damaging 1.00
R1113:Angpt2 UTSW 8 18692118 nonsense probably null
R1264:Angpt2 UTSW 8 18741217 missense probably benign 0.00
R1308:Angpt2 UTSW 8 18692118 nonsense probably null
R1518:Angpt2 UTSW 8 18705839 missense probably benign 0.00
R1595:Angpt2 UTSW 8 18698113 missense probably damaging 1.00
R2016:Angpt2 UTSW 8 18705731 missense probably damaging 0.96
R2017:Angpt2 UTSW 8 18705731 missense probably damaging 0.96
R2050:Angpt2 UTSW 8 18705657 missense probably benign
R2142:Angpt2 UTSW 8 18714140 missense probably benign 0.39
R2184:Angpt2 UTSW 8 18692116 missense probably benign 0.00
R3028:Angpt2 UTSW 8 18703544 missense probably benign 0.01
R4096:Angpt2 UTSW 8 18698095 missense probably damaging 0.97
R4112:Angpt2 UTSW 8 18699123 missense probably damaging 1.00
R4738:Angpt2 UTSW 8 18741059 missense probably benign 0.07
R4790:Angpt2 UTSW 8 18714082 missense probably damaging 1.00
R4935:Angpt2 UTSW 8 18692115 missense probably damaging 1.00
R6056:Angpt2 UTSW 8 18698116 missense probably benign 0.00
R6499:Angpt2 UTSW 8 18694517 missense probably benign
R6938:Angpt2 UTSW 8 18698089 nonsense probably null
R7211:Angpt2 UTSW 8 18741131 missense probably benign
R7323:Angpt2 UTSW 8 18705824 missense probably benign 0.13
R7349:Angpt2 UTSW 8 18692074 missense probably damaging 0.99
R7812:Angpt2 UTSW 8 18692145 missense probably benign 0.43
Predicted Primers PCR Primer
(F):5'- TGTTTCTCCAGACTGCAGTGC -3'
(R):5'- GCAGCTACCCAGTCCTAATTGC -3'

Sequencing Primer
(F):5'- TCCAGACTGCAGTGCCTTTGG -3'
(R):5'- AGCTACCCAGTCCTAATTGCTTCTG -3'
Posted On2019-11-26