Incidental Mutation 'R7746:Sbno2'
ID596846
Institutional Source Beutler Lab
Gene Symbol Sbno2
Ensembl Gene ENSMUSG00000035673
Gene Namestrawberry notch 2
SynonymsStno
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.304) question?
Stock #R7746 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location80056992-80105571 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 80058874 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 1012 (I1012M)
Ref Sequence ENSEMBL: ENSMUSP00000151854 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042771] [ENSMUST00000097227] [ENSMUST00000105372] [ENSMUST00000183037] [ENSMUST00000217972] [ENSMUST00000218630] [ENSMUST00000219260]
Predicted Effect possibly damaging
Transcript: ENSMUST00000042771
AA Change: I1012M

PolyPhen 2 Score 0.791 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000041635
Gene: ENSMUSG00000035673
AA Change: I1012M

DomainStartEndE-ValueType
low complexity region 96 112 N/A INTRINSIC
low complexity region 177 189 N/A INTRINSIC
Pfam:AAA_34 209 500 8.2e-135 PFAM
Pfam:ResIII 239 419 7.7e-8 PFAM
low complexity region 611 631 N/A INTRINSIC
Pfam:Helicase_C_4 726 1004 7.5e-120 PFAM
low complexity region 1263 1283 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097227
SMART Domains Protein: ENSMUSP00000094863
Gene: ENSMUSG00000075706

DomainStartEndE-ValueType
low complexity region 2 55 N/A INTRINSIC
Pfam:GSHPx 97 204 6e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105372
SMART Domains Protein: ENSMUSP00000101011
Gene: ENSMUSG00000075706

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:GSHPx 41 148 1.3e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000183037
SMART Domains Protein: ENSMUSP00000138186
Gene: ENSMUSG00000075706

DomainStartEndE-ValueType
Pfam:GSHPx 1 108 3.6e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000217972
Predicted Effect probably damaging
Transcript: ENSMUST00000218630
AA Change: I1012M

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Predicted Effect possibly damaging
Transcript: ENSMUST00000219260
AA Change: I1012M

PolyPhen 2 Score 0.791 (Sensitivity: 0.85; Specificity: 0.93)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired osteoclast fusion, impaired osteoblastogenesis, osteopetrosis, increased bone mass, and decreased body weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik A T 2: 68,728,995 Q184L probably benign Het
9030624G23Rik T G 12: 24,074,673 S68R possibly damaging Het
Acyp1 G T 12: 85,279,058 R56S unknown Het
Angpt2 C T 8: 18,692,064 R492Q probably damaging Het
Ankrd36 T C 11: 5,687,451 L1340P possibly damaging Het
Arhgef33 G C 17: 80,347,120 probably null Het
Bach1 G A 16: 87,729,633 S661N probably benign Het
Bik T C 15: 83,541,334 I12T possibly damaging Het
C3 C T 17: 57,218,859 R841H probably damaging Het
Cacna1s G T 1: 136,069,018 R119L probably damaging Het
Cic G A 7: 25,288,782 V1632M probably damaging Het
Ctif CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC 18: 75,471,803 probably benign Het
Dchs2 A G 3: 83,128,057 H37R possibly damaging Het
Dvl1 A G 4: 155,856,239 I439V possibly damaging Het
Fam19a1 T C 6: 96,115,756 probably null Het
Fat1 G A 8: 44,951,633 D474N probably damaging Het
Foxs1 T A 2: 152,933,108 E8D probably benign Het
Garnl3 T C 2: 32,992,257 D822G probably damaging Het
Gm11397 A T 13: 33,397,858 I133L probably damaging Het
Gm11756 C T 4: 73,919,862 S29N possibly damaging Het
Gm44501 C T 17: 40,578,829 A78V possibly damaging Het
Gpr19 C A 6: 134,869,392 A443S probably damaging Het
Helb T C 10: 120,095,102 R729G probably null Het
Lnpep G T 17: 17,538,562 T840K probably benign Het
Mctp2 T C 7: 72,185,796 N551S probably benign Het
Mgam T G 6: 40,668,193 F635V probably damaging Het
Mlc1 G A 15: 88,964,170 A262V probably damaging Het
Muc5b A G 7: 141,862,239 Y2974C probably benign Het
Nprl3 A T 11: 32,248,150 Y208* probably null Het
Olfr1090 A T 2: 86,754,093 L215Q probably damaging Het
Olfr136 C T 17: 38,335,394 P79L probably benign Het
Pkn2 A G 3: 142,794,107 F915S probably damaging Het
Pkn3 G A 2: 30,090,584 C829Y probably benign Het
Polr1a C T 6: 71,941,512 P685S probably damaging Het
Ppp4r3b A G 11: 29,173,352 D16G probably benign Het
Ppwd1 C T 13: 104,217,206 R348H probably damaging Het
Pxdc1 T C 13: 34,639,063 T98A probably benign Het
Rhbdl1 T C 17: 25,836,193 I68V probably benign Het
Ror2 A G 13: 53,117,225 C365R probably damaging Het
Samd4b A T 7: 28,403,903 H43Q probably damaging Het
Sbf2 A T 7: 110,441,426 V398D probably benign Het
Strn T C 17: 78,677,372 T281A probably benign Het
Syt4 T A 18: 31,444,265 D12V probably benign Het
Tmem45a A G 16: 56,825,737 L40P probably damaging Het
Tnn G A 1: 160,114,685 P1081L probably damaging Het
Unc80 T C 1: 66,677,385 V2888A probably benign Het
Other mutations in Sbno2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Sbno2 APN 10 80064506 splice site probably benign
IGL01773:Sbno2 APN 10 80057831 missense probably damaging 1.00
IGL01869:Sbno2 APN 10 80060392 critical splice donor site probably null
IGL01911:Sbno2 APN 10 80069624 nonsense probably null
IGL02071:Sbno2 APN 10 80060641 missense probably damaging 1.00
IGL02094:Sbno2 APN 10 80057645 missense probably benign
IGL02220:Sbno2 APN 10 80072368 missense probably benign 0.04
IGL02366:Sbno2 APN 10 80064202 missense probably damaging 1.00
IGL02608:Sbno2 APN 10 80067402 splice site probably null
IGL03007:Sbno2 APN 10 80058550 splice site probably benign
IGL03083:Sbno2 APN 10 80057534 missense probably damaging 0.98
IGL03393:Sbno2 APN 10 80066901 missense probably damaging 1.00
R0034:Sbno2 UTSW 10 80058340 splice site probably benign
R0126:Sbno2 UTSW 10 80068853 splice site probably null
R0652:Sbno2 UTSW 10 80067294 missense probably damaging 1.00
R0964:Sbno2 UTSW 10 80084259 missense possibly damaging 0.75
R1571:Sbno2 UTSW 10 80060392 critical splice donor site probably null
R1601:Sbno2 UTSW 10 80060492 missense probably damaging 0.98
R1634:Sbno2 UTSW 10 80060634 missense possibly damaging 0.73
R1733:Sbno2 UTSW 10 80058508 missense possibly damaging 0.92
R1762:Sbno2 UTSW 10 80066606 missense probably damaging 1.00
R1832:Sbno2 UTSW 10 80060605 nonsense probably null
R1859:Sbno2 UTSW 10 80058639 nonsense probably null
R2086:Sbno2 UTSW 10 80057856 missense possibly damaging 0.89
R2136:Sbno2 UTSW 10 80062693 missense probably damaging 1.00
R2360:Sbno2 UTSW 10 80058021 missense possibly damaging 0.81
R4426:Sbno2 UTSW 10 80072358 missense probably null 0.02
R4504:Sbno2 UTSW 10 80060492 missense possibly damaging 0.46
R4692:Sbno2 UTSW 10 80086327 missense possibly damaging 0.90
R5044:Sbno2 UTSW 10 80062188 missense probably benign 0.11
R5166:Sbno2 UTSW 10 80066928 nonsense probably null
R5576:Sbno2 UTSW 10 80067337 missense probably damaging 0.99
R5665:Sbno2 UTSW 10 80058453 missense probably benign 0.00
R5709:Sbno2 UTSW 10 80086337 start codon destroyed probably null 0.89
R5828:Sbno2 UTSW 10 80066590 missense possibly damaging 0.84
R6192:Sbno2 UTSW 10 80060016 missense probably damaging 0.99
R6971:Sbno2 UTSW 10 80060034 missense possibly damaging 0.95
R7012:Sbno2 UTSW 10 80069518 intron probably benign
R7082:Sbno2 UTSW 10 80060090 splice site probably null
R7133:Sbno2 UTSW 10 80086312 missense probably damaging 1.00
R7438:Sbno2 UTSW 10 80069575 missense unknown
R7481:Sbno2 UTSW 10 80057499 missense probably benign 0.11
R7964:Sbno2 UTSW 10 80068351 missense probably damaging 1.00
R8055:Sbno2 UTSW 10 80069431 missense possibly damaging 0.81
R8221:Sbno2 UTSW 10 80070011 missense probably benign
R8329:Sbno2 UTSW 10 80064387 missense probably damaging 1.00
X0026:Sbno2 UTSW 10 80057459 missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- GCGACCTAGTTAATGCCTCTTC -3'
(R):5'- AGCTATGCACAGCAGGACAC -3'

Sequencing Primer
(F):5'- CCCACTTCATACCGCGG -3'
(R):5'- AGTACCCCAGACCAGAGGG -3'
Posted On2019-11-26