Incidental Mutation 'R0632:Ap4e1'
ID 59685
Institutional Source Beutler Lab
Gene Symbol Ap4e1
Ensembl Gene ENSMUSG00000001998
Gene Name adaptor-related protein complex AP-4, epsilon 1
Synonyms 2310033A20Rik
MMRRC Submission 038821-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.129) question?
Stock # R0632 (G1)
Quality Score 215
Status Validated
Chromosome 2
Chromosomal Location 126850637-126909829 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) C to A at 126891200 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 522 (Y522*)
Ref Sequence ENSEMBL: ENSMUSP00000002063 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002063] [ENSMUST00000110394] [ENSMUST00000142740] [ENSMUST00000175663] [ENSMUST00000177372]
AlphaFold Q80V94
Predicted Effect probably null
Transcript: ENSMUST00000002063
AA Change: Y522*
SMART Domains Protein: ENSMUSP00000002063
Gene: ENSMUSG00000001998
AA Change: Y522*

DomainStartEndE-ValueType
Pfam:Adaptin_N 51 600 5.9e-90 PFAM
low complexity region 841 853 N/A INTRINSIC
AP4E_app_platf 1017 1120 4.2e-51 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110394
SMART Domains Protein: ENSMUSP00000106024
Gene: ENSMUSG00000001998

DomainStartEndE-ValueType
Pfam:Adaptin_N 51 392 2.4e-66 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142740
Predicted Effect probably benign
Transcript: ENSMUST00000175663
SMART Domains Protein: ENSMUSP00000135599
Gene: ENSMUSG00000001998

DomainStartEndE-ValueType
Pfam:Adaptin_N 51 355 1.3e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177372
SMART Domains Protein: ENSMUSP00000135449
Gene: ENSMUSG00000001998

DomainStartEndE-ValueType
Pfam:Adaptin_N 51 291 2.5e-47 PFAM
Meta Mutation Damage Score 0.9711 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.0%
Validation Efficiency 95% (81/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the adaptor complexes large subunit protein family. These proteins are components of the heterotetrameric adaptor protein complexes, which play important roles in the secretory and endocytic pathways by mediating vesicle formation and sorting of integral membrane proteins. The encoded protein is a large subunit of adaptor protein complex-4, which is associated with both clathrin- and nonclathrin-coated vesicles. Disruption of this gene may be associated with cerebral palsy. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit enlarged lateral ventricles, decreased corpus callosum size, decreased vertical activity, and female anemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaa1a T A 9: 119,176,884 (GRCm39) probably benign Het
Adgrg7 T A 16: 56,562,952 (GRCm39) T462S possibly damaging Het
Akap6 A T 12: 52,983,931 (GRCm39) N825I probably damaging Het
Ankib1 T A 5: 3,822,529 (GRCm39) N59I probably benign Het
Anks6 T C 4: 47,033,167 (GRCm39) S633G possibly damaging Het
Art5 G A 7: 101,747,164 (GRCm39) T205I probably damaging Het
Ascc2 T A 11: 4,599,855 (GRCm39) L176H probably damaging Het
Atp13a5 T C 16: 29,117,026 (GRCm39) D529G probably benign Het
C2cd4a T C 9: 67,738,845 (GRCm39) E66G probably benign Het
C8a T C 4: 104,713,689 (GRCm39) D147G probably damaging Het
Ccdc14 T C 16: 34,542,019 (GRCm39) V532A possibly damaging Het
Ccdc88a T A 11: 29,432,749 (GRCm39) probably benign Het
Cfap54 C T 10: 92,720,958 (GRCm39) E2543K unknown Het
Cldn13 C T 5: 134,943,601 (GRCm39) E195K probably benign Het
Cp A G 3: 20,025,246 (GRCm39) S402G probably null Het
Cpa3 T C 3: 20,279,358 (GRCm39) T194A probably benign Het
Crygf C A 1: 65,967,156 (GRCm39) Y93* probably null Het
Ctsh A G 9: 89,943,635 (GRCm39) R87G possibly damaging Het
Cyp2t4 A G 7: 26,857,671 (GRCm39) D428G possibly damaging Het
Dnah17 C G 11: 117,958,508 (GRCm39) probably benign Het
Dnah3 A G 7: 119,567,128 (GRCm39) V2366A probably benign Het
Dscaml1 A T 9: 45,643,432 (GRCm39) I1284F probably benign Het
Dsg1c T C 18: 20,405,403 (GRCm39) probably benign Het
Dst G T 1: 34,310,494 (GRCm39) R4098L probably damaging Het
Efhb A G 17: 53,720,487 (GRCm39) probably benign Het
Epha7 A T 4: 28,821,104 (GRCm39) I90F probably damaging Het
Fam171a2 T A 11: 102,328,707 (GRCm39) D684V probably damaging Het
Fan1 A G 7: 64,012,947 (GRCm39) V665A possibly damaging Het
Fbn2 A G 18: 58,170,819 (GRCm39) C2191R probably damaging Het
Fkbp3 G A 12: 65,120,692 (GRCm39) A2V probably benign Het
G6pd2 A G 5: 61,967,514 (GRCm39) N430D probably benign Het
Gm13547 T A 2: 29,651,596 (GRCm39) D7E possibly damaging Het
H4c9 G T 13: 22,225,197 (GRCm39) Y99* probably null Het
Hdac5 A T 11: 102,096,638 (GRCm39) D260E probably damaging Het
Hsf2bp T C 17: 32,232,320 (GRCm39) E142G probably damaging Het
Igf1r C T 7: 67,814,903 (GRCm39) T268I probably damaging Het
Inava T C 1: 136,155,356 (GRCm39) D83G probably benign Het
Kcne3 C T 7: 99,833,646 (GRCm39) R88C probably damaging Het
Klk1b9 G T 7: 43,628,796 (GRCm39) G100V possibly damaging Het
Kmt2d G A 15: 98,751,462 (GRCm39) probably benign Het
Lama1 C T 17: 68,059,363 (GRCm39) probably benign Het
Lcp2 C T 11: 34,032,426 (GRCm39) P335S possibly damaging Het
Lrrk2 T A 15: 91,680,231 (GRCm39) N2047K probably damaging Het
Mcub T C 3: 129,712,375 (GRCm39) M167V probably benign Het
Mia2 T C 12: 59,182,929 (GRCm39) L36P probably damaging Het
Mmp13 G A 9: 7,274,032 (GRCm39) G169R probably damaging Het
Mmp13 A T 9: 7,282,077 (GRCm39) I460F possibly damaging Het
Msh4 A G 3: 153,602,532 (GRCm39) I232T probably damaging Het
Msra T A 14: 64,447,981 (GRCm39) M145L probably benign Het
Myo7a A T 7: 97,761,357 (GRCm39) probably benign Het
Nme8 A T 13: 19,842,206 (GRCm39) N422K probably damaging Het
Nol6 A T 4: 41,121,115 (GRCm39) F353I probably damaging Het
Nphp3 A G 9: 103,895,473 (GRCm39) K384E probably damaging Het
Or51h5 C T 7: 102,577,811 (GRCm39) probably null Het
Or52e15 A G 7: 104,645,910 (GRCm39) I67T probably benign Het
Or52h7 A G 7: 104,213,544 (GRCm39) I39V probably benign Het
Phox2b T G 5: 67,253,557 (GRCm39) probably benign Het
Plec A T 15: 76,057,611 (GRCm39) S4131T probably damaging Het
Pptc7 G A 5: 122,451,654 (GRCm39) probably benign Het
Pramel31 G A 4: 144,090,352 (GRCm39) C464Y probably damaging Het
Prpf40b A G 15: 99,214,170 (GRCm39) E810G probably benign Het
Ptprc C T 1: 138,001,348 (GRCm39) V965I probably benign Het
Pum1 T A 4: 130,455,415 (GRCm39) M180K probably benign Het
Ranbp3 T C 17: 57,009,896 (GRCm39) probably benign Het
Rasgrf2 A G 13: 92,120,393 (GRCm39) S787P probably benign Het
Rnf19b T A 4: 128,967,344 (GRCm39) N294K probably damaging Het
Samd3 A T 10: 26,120,393 (GRCm39) H156L possibly damaging Het
Serpinb6c C T 13: 34,064,014 (GRCm39) R347Q possibly damaging Het
Slc36a3 A G 11: 55,015,906 (GRCm39) I416T probably damaging Het
Slc4a4 T A 5: 89,277,500 (GRCm39) F279Y probably damaging Het
Slc6a2 T A 8: 93,719,429 (GRCm39) probably benign Het
Snrnp40 C G 4: 130,271,836 (GRCm39) probably null Het
Tab2 A G 10: 7,795,565 (GRCm39) S232P probably benign Het
Tacc2 A T 7: 130,227,325 (GRCm39) K1356* probably null Het
Tmem87a A G 2: 120,190,023 (GRCm39) S544P probably damaging Het
Trim52 T A 14: 106,344,401 (GRCm39) C20S probably damaging Het
Usp38 A T 8: 81,740,779 (GRCm39) V96E probably benign Het
Vmn2r59 T C 7: 41,708,308 (GRCm39) Y33C probably damaging Het
Vsig10l T G 7: 43,113,561 (GRCm39) V171G probably damaging Het
Zfp957 T A 14: 79,450,360 (GRCm39) I480F probably damaging Het
Other mutations in Ap4e1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Ap4e1 APN 2 126,870,201 (GRCm39) missense probably damaging 1.00
IGL00423:Ap4e1 APN 2 126,870,209 (GRCm39) missense probably damaging 0.99
IGL00659:Ap4e1 APN 2 126,905,221 (GRCm39) missense probably benign 0.30
IGL01155:Ap4e1 APN 2 126,885,365 (GRCm39) missense probably damaging 1.00
IGL01672:Ap4e1 APN 2 126,894,109 (GRCm39) missense probably damaging 1.00
IGL01866:Ap4e1 APN 2 126,888,830 (GRCm39) missense possibly damaging 0.83
IGL01940:Ap4e1 APN 2 126,885,431 (GRCm39) missense probably damaging 0.97
IGL02131:Ap4e1 APN 2 126,903,849 (GRCm39) missense probably benign
IGL02207:Ap4e1 APN 2 126,853,736 (GRCm39) missense probably damaging 1.00
IGL03394:Ap4e1 APN 2 126,905,317 (GRCm39) missense probably benign 0.18
quickstep UTSW 2 126,850,822 (GRCm39) critical splice donor site probably null
K7371:Ap4e1 UTSW 2 126,908,456 (GRCm39) unclassified probably benign
R0090:Ap4e1 UTSW 2 126,906,905 (GRCm39) missense possibly damaging 0.70
R0420:Ap4e1 UTSW 2 126,891,280 (GRCm39) missense probably damaging 1.00
R0490:Ap4e1 UTSW 2 126,888,106 (GRCm39) missense probably damaging 1.00
R0670:Ap4e1 UTSW 2 126,853,784 (GRCm39) critical splice donor site probably null
R0698:Ap4e1 UTSW 2 126,905,283 (GRCm39) missense probably benign 0.00
R1183:Ap4e1 UTSW 2 126,856,121 (GRCm39) missense probably damaging 0.98
R1338:Ap4e1 UTSW 2 126,888,829 (GRCm39) missense probably damaging 1.00
R1513:Ap4e1 UTSW 2 126,903,475 (GRCm39) missense probably null 1.00
R1528:Ap4e1 UTSW 2 126,853,743 (GRCm39) missense possibly damaging 0.50
R1994:Ap4e1 UTSW 2 126,903,467 (GRCm39) missense probably benign 0.00
R2270:Ap4e1 UTSW 2 126,889,083 (GRCm39) critical splice donor site probably null
R2271:Ap4e1 UTSW 2 126,889,083 (GRCm39) critical splice donor site probably null
R3108:Ap4e1 UTSW 2 126,898,226 (GRCm39) critical splice donor site probably null
R4019:Ap4e1 UTSW 2 126,903,846 (GRCm39) missense probably benign 0.01
R4020:Ap4e1 UTSW 2 126,903,846 (GRCm39) missense probably benign 0.01
R4454:Ap4e1 UTSW 2 126,889,061 (GRCm39) missense probably damaging 1.00
R4691:Ap4e1 UTSW 2 126,903,791 (GRCm39) missense probably benign 0.08
R4767:Ap4e1 UTSW 2 126,902,358 (GRCm39) missense probably benign
R4803:Ap4e1 UTSW 2 126,891,479 (GRCm39) missense probably benign 0.20
R4804:Ap4e1 UTSW 2 126,885,678 (GRCm39) critical splice donor site probably null
R5155:Ap4e1 UTSW 2 126,905,289 (GRCm39) missense probably benign 0.02
R5157:Ap4e1 UTSW 2 126,903,615 (GRCm39) missense probably benign 0.00
R5248:Ap4e1 UTSW 2 126,906,842 (GRCm39) missense possibly damaging 0.95
R5363:Ap4e1 UTSW 2 126,879,784 (GRCm39) splice site probably null
R5507:Ap4e1 UTSW 2 126,850,818 (GRCm39) missense probably damaging 0.98
R5642:Ap4e1 UTSW 2 126,906,899 (GRCm39) missense possibly damaging 0.67
R6122:Ap4e1 UTSW 2 126,870,080 (GRCm39) splice site probably null
R6180:Ap4e1 UTSW 2 126,908,508 (GRCm39) nonsense probably null
R6298:Ap4e1 UTSW 2 126,889,035 (GRCm39) missense probably benign 0.00
R6329:Ap4e1 UTSW 2 126,903,636 (GRCm39) missense probably benign 0.10
R6543:Ap4e1 UTSW 2 126,908,525 (GRCm39) missense probably benign 0.03
R6954:Ap4e1 UTSW 2 126,906,871 (GRCm39) missense probably benign 0.01
R7144:Ap4e1 UTSW 2 126,853,727 (GRCm39) missense probably damaging 0.99
R7165:Ap4e1 UTSW 2 126,905,238 (GRCm39) missense possibly damaging 0.48
R7348:Ap4e1 UTSW 2 126,903,897 (GRCm39) missense possibly damaging 0.76
R7348:Ap4e1 UTSW 2 126,903,896 (GRCm39) missense probably damaging 0.96
R7382:Ap4e1 UTSW 2 126,850,822 (GRCm39) critical splice donor site probably null
R7571:Ap4e1 UTSW 2 126,861,256 (GRCm39) missense probably damaging 1.00
R7768:Ap4e1 UTSW 2 126,888,854 (GRCm39) missense probably damaging 1.00
R8875:Ap4e1 UTSW 2 126,877,100 (GRCm39) missense probably damaging 1.00
R9135:Ap4e1 UTSW 2 126,861,242 (GRCm39) missense probably damaging 1.00
R9592:Ap4e1 UTSW 2 126,903,588 (GRCm39) missense probably benign 0.14
R9701:Ap4e1 UTSW 2 126,875,563 (GRCm39) missense probably benign 0.01
X0060:Ap4e1 UTSW 2 126,905,330 (GRCm39) missense probably benign 0.01
X0065:Ap4e1 UTSW 2 126,903,570 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAACCAGCGTCTATCTGGAAACTCG -3'
(R):5'- CCTGAAGCAGGCTCTTCATAAGCTC -3'

Sequencing Primer
(F):5'- TCTATCTGGAAACTCGGAAGAATG -3'
(R):5'- GCTGTCTCAGACAAGTATTCAAGG -3'
Posted On 2013-07-11