Mutagenetix > Incidental Mutations

Incidental Mutation 'R0632:Ap4e1'

59685

Institutional Source

Beutler Lab

Gene Symbol

Ap4e1

Ensembl Gene

ENSMUSG00000001998

Gene Name

adaptor-related protein complex AP-4, epsilon 1

Synonyms

2310033A20Rik

MMRRC Submission

038821-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.116) question?

Stock #

R0632 (G1)

Quality Score

215

Status

Validated

Chromosome

Chromosomal Location

127008717-127067909 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to A at 127049280 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 522 (Y522*)

Ref Sequence

ENSEMBL: ENSMUSP00000002063 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000002063] [ENSMUST00000110394] [ENSMUST00000142740] [ENSMUST00000175663] [ENSMUST00000177372]

AlphaFold

Q80V94

Predicted Effect

probably null
Transcript: ENSMUST00000002063
AA Change: Y522*

SMART Domains

Protein: ENSMUSP00000002063
Gene: ENSMUSG00000001998
AA Change: Y522*

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	51	600	5.9e-90	PFAM
low complexity region	841	853	N/A	INTRINSIC
AP4E_app_platf	1017	1120	4.2e-51	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000110394

SMART Domains

Protein: ENSMUSP00000106024
Gene: ENSMUSG00000001998

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	51	392	2.4e-66	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000142740

Predicted Effect

probably benign
Transcript: ENSMUST00000175663

SMART Domains

Protein: ENSMUSP00000135599
Gene: ENSMUSG00000001998

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	51	355	1.3e-59	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000177372

SMART Domains

Protein: ENSMUSP00000135449
Gene: ENSMUSG00000001998

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	51	291	2.5e-47	PFAM

Meta Mutation Damage Score

0.9711

Coding Region Coverage

1x: 99.4%
3x: 99.0%
10x: 97.8%
20x: 96.0%

Validation Efficiency

95% (81/85)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the adaptor complexes large subunit protein family. These proteins are components of the heterotetrameric adaptor protein complexes, which play important roles in the secretory and endocytic pathways by mediating vesicle formation and sorting of integral membrane proteins. The encoded protein is a large subunit of adaptor protein complex-4, which is associated with both clathrin- and nonclathrin-coated vesicles. Disruption of this gene may be associated with cerebral palsy. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit enlarged lateral ventricles, decreased corpus callosum size, decreased vertical activity, and female anemia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5730559C18Rik	T	C	1: 136,227,618	D83G	probably benign	Het
Acaa1a	T	A	9: 119,347,818		probably benign	Het
Adgrg7	T	A	16: 56,742,589	T462S	possibly damaging	Het
Akap6	A	T	12: 52,937,148	N825I	probably damaging	Het
Ankib1	T	A	5: 3,772,529	N59I	probably benign	Het
Anks6	T	C	4: 47,033,167	S633G	possibly damaging	Het
Art5	G	A	7: 102,097,957	T205I	probably damaging	Het
Ascc2	T	A	11: 4,649,855	L176H	probably damaging	Het
Atp13a5	T	C	16: 29,298,208	D529G	probably benign	Het
C2cd4a	T	C	9: 67,831,563	E66G	probably benign	Het
C8a	T	C	4: 104,856,492	D147G	probably damaging	Het
Ccdc109b	T	C	3: 129,918,726	M167V	probably benign	Het
Ccdc14	T	C	16: 34,721,649	V532A	possibly damaging	Het
Ccdc88a	T	A	11: 29,482,749		probably benign	Het
Cfap54	C	T	10: 92,885,096	E2543K	unknown	Het
Cldn13	C	T	5: 134,914,747	E195K	probably benign	Het
Cp	A	G	3: 19,971,082	S402G	probably null	Het
Cpa3	T	C	3: 20,225,194	T194A	probably benign	Het
Crygf	C	A	1: 65,927,997	Y93*	probably null	Het
Ctsh	A	G	9: 90,061,582	R87G	possibly damaging	Het
Cyp2t4	A	G	7: 27,158,246	D428G	possibly damaging	Het
Dnah17	C	G	11: 118,067,682		probably benign	Het
Dnah3	A	G	7: 119,967,905	V2366A	probably benign	Het
Dscaml1	A	T	9: 45,732,134	I1284F	probably benign	Het
Dsg1c	T	C	18: 20,272,346		probably benign	Het
Dst	G	T	1: 34,271,413	R4098L	probably damaging	Het
Efhb	A	G	17: 53,413,459		probably benign	Het
Epha7	A	T	4: 28,821,104	I90F	probably damaging	Het
Fam171a2	T	A	11: 102,437,881	D684V	probably damaging	Het
Fan1	A	G	7: 64,363,199	V665A	possibly damaging	Het
Fbn2	A	G	18: 58,037,747	C2191R	probably damaging	Het
Fkbp3	G	A	12: 65,073,918	A2V	probably benign	Het
G6pd2	A	G	5: 61,810,171	N430D	probably benign	Het
Gm13119	G	A	4: 144,363,782	C464Y	probably damaging	Het
Gm13547	T	A	2: 29,761,584	D7E	possibly damaging	Het
Hdac5	A	T	11: 102,205,812	D260E	probably damaging	Het
Hist1h4i	G	T	13: 22,041,027	Y99*	probably null	Het
Hsf2bp	T	C	17: 32,013,346	E142G	probably damaging	Het
Igf1r	C	T	7: 68,165,155	T268I	probably damaging	Het
Kcne3	C	T	7: 100,184,439	R88C	probably damaging	Het
Klk1b9	G	T	7: 43,979,372	G100V	possibly damaging	Het
Kmt2d	G	A	15: 98,853,581		probably benign	Het
Lama1	C	T	17: 67,752,368		probably benign	Het
Lcp2	C	T	11: 34,082,426	P335S	possibly damaging	Het
Lrrk2	T	A	15: 91,796,028	N2047K	probably damaging	Het
Mia2	T	C	12: 59,136,143	L36P	probably damaging	Het
Mmp13	G	A	9: 7,274,032	G169R	probably damaging	Het
Mmp13	A	T	9: 7,282,077	I460F	possibly damaging	Het
Msh4	A	G	3: 153,896,895	I232T	probably damaging	Het
Msra	T	A	14: 64,210,532	M145L	probably benign	Het
Myo7a	A	T	7: 98,112,150		probably benign	Het
Nme8	A	T	13: 19,658,036	N422K	probably damaging	Het
Nol6	A	T	4: 41,121,115	F353I	probably damaging	Het
Nphp3	A	G	9: 104,018,274	K384E	probably damaging	Het
Olfr572	C	T	7: 102,928,604		probably null	Het
Olfr652	A	G	7: 104,564,337	I39V	probably benign	Het
Olfr672	A	G	7: 104,996,703	I67T	probably benign	Het
Phox2b	T	G	5: 67,096,214		probably benign	Het
Plec	A	T	15: 76,173,411	S4131T	probably damaging	Het
Pptc7	G	A	5: 122,313,591		probably benign	Het
Prpf40b	A	G	15: 99,316,289	E810G	probably benign	Het
Ptprc	C	T	1: 138,073,610	V965I	probably benign	Het
Pum1	T	A	4: 130,728,104	M180K	probably benign	Het
Ranbp3	T	C	17: 56,702,896		probably benign	Het
Rasgrf2	A	G	13: 91,972,274	S787P	probably benign	Het
Rnf19b	T	A	4: 129,073,551	N294K	probably damaging	Het
Samd3	A	T	10: 26,244,495	H156L	possibly damaging	Het
Serpinb6c	C	T	13: 33,880,031	R347Q	possibly damaging	Het
Slc36a3	A	G	11: 55,125,080	I416T	probably damaging	Het
Slc4a4	T	A	5: 89,129,641	F279Y	probably damaging	Het
Slc6a2	T	A	8: 92,992,801		probably benign	Het
Snrnp40	C	G	4: 130,378,043		probably null	Het
Tab2	A	G	10: 7,919,801	S232P	probably benign	Het
Tacc2	A	T	7: 130,625,595	K1356*	probably null	Het
Tmem87a	A	G	2: 120,359,542	S544P	probably damaging	Het
Trim52	T	A	14: 106,106,967	C20S	probably damaging	Het
Usp38	A	T	8: 81,014,150	V96E	probably benign	Het
Vmn2r59	T	C	7: 42,058,884	Y33C	probably damaging	Het
Vsig10l	T	G	7: 43,464,137	V171G	probably damaging	Het
Zfp957	T	A	14: 79,212,920	I480F	probably damaging	Het

Other mutations in Ap4e1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00236:Ap4e1	APN	2	127028281	missense	probably damaging	1.00
IGL00423:Ap4e1	APN	2	127028289	missense	probably damaging	0.99
IGL00659:Ap4e1	APN	2	127063301	missense	probably benign	0.30
IGL01155:Ap4e1	APN	2	127043445	missense	probably damaging	1.00
IGL01672:Ap4e1	APN	2	127052189	missense	probably damaging	1.00
IGL01866:Ap4e1	APN	2	127046910	missense	possibly damaging	0.83
IGL01940:Ap4e1	APN	2	127043511	missense	probably damaging	0.97
IGL02131:Ap4e1	APN	2	127061929	missense	probably benign
IGL02207:Ap4e1	APN	2	127011816	missense	probably damaging	1.00
IGL03394:Ap4e1	APN	2	127063397	missense	probably benign	0.18
quickstep	UTSW	2	127008902	critical splice donor site	probably null
K7371:Ap4e1	UTSW	2	127066536	unclassified	probably benign
R0090:Ap4e1	UTSW	2	127064985	missense	possibly damaging	0.70
R0420:Ap4e1	UTSW	2	127049360	missense	probably damaging	1.00
R0490:Ap4e1	UTSW	2	127046186	missense	probably damaging	1.00
R0670:Ap4e1	UTSW	2	127011864	critical splice donor site	probably null
R0698:Ap4e1	UTSW	2	127063363	missense	probably benign	0.00
R1183:Ap4e1	UTSW	2	127014201	missense	probably damaging	0.98
R1338:Ap4e1	UTSW	2	127046909	missense	probably damaging	1.00
R1513:Ap4e1	UTSW	2	127061555	missense	probably null	1.00
R1528:Ap4e1	UTSW	2	127011823	missense	possibly damaging	0.50
R1994:Ap4e1	UTSW	2	127061547	missense	probably benign	0.00
R2270:Ap4e1	UTSW	2	127047163	critical splice donor site	probably null
R2271:Ap4e1	UTSW	2	127047163	critical splice donor site	probably null
R3108:Ap4e1	UTSW	2	127056306	critical splice donor site	probably null
R4019:Ap4e1	UTSW	2	127061926	missense	probably benign	0.01
R4020:Ap4e1	UTSW	2	127061926	missense	probably benign	0.01
R4454:Ap4e1	UTSW	2	127047141	missense	probably damaging	1.00
R4691:Ap4e1	UTSW	2	127061871	missense	probably benign	0.08
R4767:Ap4e1	UTSW	2	127060438	missense	probably benign
R4803:Ap4e1	UTSW	2	127049559	missense	probably benign	0.20
R4804:Ap4e1	UTSW	2	127043758	critical splice donor site	probably null
R5155:Ap4e1	UTSW	2	127063369	missense	probably benign	0.02
R5157:Ap4e1	UTSW	2	127061695	missense	probably benign	0.00
R5248:Ap4e1	UTSW	2	127064922	missense	possibly damaging	0.95
R5363:Ap4e1	UTSW	2	127037864	splice site	probably null
R5507:Ap4e1	UTSW	2	127008898	missense	probably damaging	0.98
R5642:Ap4e1	UTSW	2	127064979	missense	possibly damaging	0.67
R6122:Ap4e1	UTSW	2	127028160	splice site	probably null
R6180:Ap4e1	UTSW	2	127066588	nonsense	probably null
R6298:Ap4e1	UTSW	2	127047115	missense	probably benign	0.00
R6329:Ap4e1	UTSW	2	127061716	missense	probably benign	0.10
R6543:Ap4e1	UTSW	2	127066605	missense	probably benign	0.03
R6954:Ap4e1	UTSW	2	127064951	missense	probably benign	0.01
R7144:Ap4e1	UTSW	2	127011807	missense	probably damaging	0.99
R7165:Ap4e1	UTSW	2	127063318	missense	possibly damaging	0.48
R7348:Ap4e1	UTSW	2	127061976	missense	probably damaging	0.96
R7348:Ap4e1	UTSW	2	127061977	missense	possibly damaging	0.76
R7382:Ap4e1	UTSW	2	127008902	critical splice donor site	probably null
R7571:Ap4e1	UTSW	2	127019336	missense	probably damaging	1.00
R7768:Ap4e1	UTSW	2	127046934	missense	probably damaging	1.00
R8875:Ap4e1	UTSW	2	127035180	missense	probably damaging	1.00
X0060:Ap4e1	UTSW	2	127063410	missense	probably benign	0.01
X0065:Ap4e1	UTSW	2	127061650	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- AAACCAGCGTCTATCTGGAAACTCG -3'
(R):5'- CCTGAAGCAGGCTCTTCATAAGCTC -3'

Sequencing Primer
(F):5'- TCTATCTGGAAACTCGGAAGAATG -3'
(R):5'- GCTGTCTCAGACAAGTATTCAAGG -3'

Posted On

2013-07-11