Incidental Mutation 'R7746:Nprl3'
ID 596850
Institutional Source Beutler Lab
Gene Symbol Nprl3
Ensembl Gene ENSMUSG00000020289
Gene Name nitrogen permease regulator-like 3
Synonyms Mare, HS-26, Prox1, Phg, -14 gene, HS-40, m(alpha)RE
MMRRC Submission 045802-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.224) question?
Stock # R7746 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 32181963-32217707 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 32198150 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 208 (Y208*)
Ref Sequence ENSEMBL: ENSMUSP00000020530 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020530] [ENSMUST00000109389] [ENSMUST00000124640] [ENSMUST00000129010] [ENSMUST00000136903] [ENSMUST00000137950] [ENSMUST00000141859] [ENSMUST00000149526]
AlphaFold Q8VIJ8
Predicted Effect probably null
Transcript: ENSMUST00000020530
AA Change: Y208*
SMART Domains Protein: ENSMUSP00000020530
Gene: ENSMUSG00000020289
AA Change: Y208*

DomainStartEndE-ValueType
Blast:DSPc 1 77 3e-27 BLAST
Pfam:NPR3 104 418 1.8e-44 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000109389
AA Change: Y183*
SMART Domains Protein: ENSMUSP00000105016
Gene: ENSMUSG00000020289
AA Change: Y183*

DomainStartEndE-ValueType
Pfam:NPR3 63 108 8.3e-15 PFAM
Pfam:NPR3 104 395 3.1e-80 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124640
SMART Domains Protein: ENSMUSP00000122085
Gene: ENSMUSG00000020289

DomainStartEndE-ValueType
Blast:DSPc 1 68 2e-30 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000129010
SMART Domains Protein: ENSMUSP00000123219
Gene: ENSMUSG00000020289

DomainStartEndE-ValueType
Blast:DSPc 1 59 3e-29 BLAST
Pfam:NPR3 76 131 3e-16 PFAM
Pfam:NPR3 114 182 3.7e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136903
Predicted Effect probably benign
Transcript: ENSMUST00000137950
SMART Domains Protein: ENSMUSP00000115594
Gene: ENSMUSG00000020289

DomainStartEndE-ValueType
Blast:DSPc 1 68 2e-30 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000141859
SMART Domains Protein: ENSMUSP00000120341
Gene: ENSMUSG00000020289

DomainStartEndE-ValueType
Blast:DSPc 1 59 2e-30 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000149526
SMART Domains Protein: ENSMUSP00000122231
Gene: ENSMUSG00000020289

DomainStartEndE-ValueType
Pfam:NPR3 8 72 2.7e-14 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The function of the encoded protein is not known. [provided by RefSeq, Aug 2011]
PHENOTYPE: This gene is deleted in the Hbath-J mutation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik A T 2: 68,559,339 (GRCm39) Q184L probably benign Het
9030624G23Rik T G 12: 24,124,674 (GRCm39) S68R possibly damaging Het
Acyp1 G T 12: 85,325,832 (GRCm39) R56S unknown Het
Angpt2 C T 8: 18,742,080 (GRCm39) R492Q probably damaging Het
Ankrd36 T C 11: 5,637,451 (GRCm39) L1340P possibly damaging Het
Arhgef33 G C 17: 80,654,549 (GRCm39) probably null Het
Bach1 G A 16: 87,526,521 (GRCm39) S661N probably benign Het
Bik T C 15: 83,425,535 (GRCm39) I12T possibly damaging Het
C3 C T 17: 57,525,859 (GRCm39) R841H probably damaging Het
Cacna1s G T 1: 135,996,756 (GRCm39) R119L probably damaging Het
Cic G A 7: 24,988,207 (GRCm39) V1632M probably damaging Het
Ctif CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC 18: 75,604,874 (GRCm39) probably benign Het
Dchs2 A G 3: 83,035,364 (GRCm39) H37R possibly damaging Het
Dvl1 A G 4: 155,940,696 (GRCm39) I439V possibly damaging Het
Fat1 G A 8: 45,404,670 (GRCm39) D474N probably damaging Het
Foxs1 T A 2: 152,775,028 (GRCm39) E8D probably benign Het
Garnl3 T C 2: 32,882,269 (GRCm39) D822G probably damaging Het
Gm44501 C T 17: 40,889,720 (GRCm39) A78V possibly damaging Het
Gpr19 C A 6: 134,846,355 (GRCm39) A443S probably damaging Het
Helb T C 10: 119,931,007 (GRCm39) R729G probably null Het
Lnpep G T 17: 17,758,824 (GRCm39) T840K probably benign Het
Mctp2 T C 7: 71,835,544 (GRCm39) N551S probably benign Het
Mgam T G 6: 40,645,127 (GRCm39) F635V probably damaging Het
Mlc1 G A 15: 88,848,373 (GRCm39) A262V probably damaging Het
Msantd5f9 C T 4: 73,838,099 (GRCm39) S29N possibly damaging Het
Muc5b A G 7: 141,415,976 (GRCm39) Y2974C probably benign Het
Or2n1d C T 17: 38,646,285 (GRCm39) P79L probably benign Het
Or8k40 A T 2: 86,584,437 (GRCm39) L215Q probably damaging Het
Pkn2 A G 3: 142,499,868 (GRCm39) F915S probably damaging Het
Pkn3 G A 2: 29,980,596 (GRCm39) C829Y probably benign Het
Polr1a C T 6: 71,918,496 (GRCm39) P685S probably damaging Het
Ppp4r3b A G 11: 29,123,352 (GRCm39) D16G probably benign Het
Ppwd1 C T 13: 104,353,714 (GRCm39) R348H probably damaging Het
Pxdc1 T C 13: 34,823,046 (GRCm39) T98A probably benign Het
Rhbdl1 T C 17: 26,055,167 (GRCm39) I68V probably benign Het
Ror2 A G 13: 53,271,261 (GRCm39) C365R probably damaging Het
Samd4b A T 7: 28,103,328 (GRCm39) H43Q probably damaging Het
Sbf2 A T 7: 110,040,633 (GRCm39) V398D probably benign Het
Sbno2 T C 10: 79,894,708 (GRCm39) I1012M probably damaging Het
Serpinb9h A T 13: 33,581,841 (GRCm39) I133L probably damaging Het
Strn T C 17: 78,984,801 (GRCm39) T281A probably benign Het
Syt4 T A 18: 31,577,318 (GRCm39) D12V probably benign Het
Tafa1 T C 6: 96,092,737 (GRCm39) probably null Het
Tmem45a A G 16: 56,646,100 (GRCm39) L40P probably damaging Het
Tnn G A 1: 159,942,255 (GRCm39) P1081L probably damaging Het
Unc80 T C 1: 66,716,544 (GRCm39) V2888A probably benign Het
Other mutations in Nprl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02410:Nprl3 APN 11 32,217,539 (GRCm39) start codon destroyed probably null 0.99
IGL03055:Nprl3 APN 11 32,198,230 (GRCm39) intron probably benign
IGL03366:Nprl3 APN 11 32,200,256 (GRCm39) missense probably damaging 1.00
R0114:Nprl3 UTSW 11 32,189,784 (GRCm39) unclassified probably benign
R0555:Nprl3 UTSW 11 32,183,118 (GRCm39) critical splice acceptor site probably null
R0620:Nprl3 UTSW 11 32,184,876 (GRCm39) missense probably damaging 1.00
R2008:Nprl3 UTSW 11 32,182,973 (GRCm39) missense probably damaging 0.97
R2172:Nprl3 UTSW 11 32,184,894 (GRCm39) missense probably benign 0.00
R2884:Nprl3 UTSW 11 32,198,163 (GRCm39) missense probably damaging 1.00
R3713:Nprl3 UTSW 11 32,205,464 (GRCm39) missense probably damaging 0.98
R3836:Nprl3 UTSW 11 32,183,082 (GRCm39) missense probably damaging 1.00
R4354:Nprl3 UTSW 11 32,184,906 (GRCm39) missense probably benign 0.00
R6052:Nprl3 UTSW 11 32,205,453 (GRCm39) missense possibly damaging 0.92
R6056:Nprl3 UTSW 11 32,217,432 (GRCm39) missense probably damaging 0.98
R6307:Nprl3 UTSW 11 32,189,828 (GRCm39) missense probably damaging 1.00
R6553:Nprl3 UTSW 11 32,184,812 (GRCm39) missense probably benign
R6585:Nprl3 UTSW 11 32,184,812 (GRCm39) missense probably benign
R6774:Nprl3 UTSW 11 32,187,381 (GRCm39) missense probably damaging 1.00
R6806:Nprl3 UTSW 11 32,217,509 (GRCm39) missense probably damaging 0.99
R7980:Nprl3 UTSW 11 32,187,357 (GRCm39) missense probably damaging 1.00
R8483:Nprl3 UTSW 11 32,213,083 (GRCm39) missense probably damaging 1.00
R8712:Nprl3 UTSW 11 32,187,334 (GRCm39) missense possibly damaging 0.84
R8827:Nprl3 UTSW 11 32,184,742 (GRCm39) missense probably benign 0.00
R9264:Nprl3 UTSW 11 32,183,948 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- GGGTTTCCTGAAAAGTGGCC -3'
(R):5'- GATGATGACAAGGGATTTTCTGATG -3'

Sequencing Primer
(F):5'- GTGGCCACACAAGTGTCC -3'
(R):5'- GATTGTTCCTGTTCTGACTG -3'
Posted On 2019-11-26