Incidental Mutation 'R7746:Nprl3'
ID596850
Institutional Source Beutler Lab
Gene Symbol Nprl3
Ensembl Gene ENSMUSG00000020289
Gene Namenitrogen permease regulator-like 3
SynonymsProx1, HS-26, Phg, -14 gene, HS-40, Mare, m(alpha)RE
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.189) question?
Stock #R7746 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location32225628-32267707 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 32248150 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 208 (Y208*)
Ref Sequence ENSEMBL: ENSMUSP00000020530 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020530] [ENSMUST00000109389] [ENSMUST00000124640] [ENSMUST00000129010] [ENSMUST00000136903] [ENSMUST00000137950] [ENSMUST00000141859] [ENSMUST00000149526]
Predicted Effect probably null
Transcript: ENSMUST00000020530
AA Change: Y208*
SMART Domains Protein: ENSMUSP00000020530
Gene: ENSMUSG00000020289
AA Change: Y208*

DomainStartEndE-ValueType
Blast:DSPc 1 77 3e-27 BLAST
Pfam:NPR3 104 418 1.8e-44 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000109389
AA Change: Y183*
SMART Domains Protein: ENSMUSP00000105016
Gene: ENSMUSG00000020289
AA Change: Y183*

DomainStartEndE-ValueType
Pfam:NPR3 63 108 8.3e-15 PFAM
Pfam:NPR3 104 395 3.1e-80 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124640
SMART Domains Protein: ENSMUSP00000122085
Gene: ENSMUSG00000020289

DomainStartEndE-ValueType
Blast:DSPc 1 68 2e-30 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000129010
SMART Domains Protein: ENSMUSP00000123219
Gene: ENSMUSG00000020289

DomainStartEndE-ValueType
Blast:DSPc 1 59 3e-29 BLAST
Pfam:NPR3 76 131 3e-16 PFAM
Pfam:NPR3 114 182 3.7e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136903
Predicted Effect probably benign
Transcript: ENSMUST00000137950
SMART Domains Protein: ENSMUSP00000115594
Gene: ENSMUSG00000020289

DomainStartEndE-ValueType
Blast:DSPc 1 68 2e-30 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000141859
SMART Domains Protein: ENSMUSP00000120341
Gene: ENSMUSG00000020289

DomainStartEndE-ValueType
Blast:DSPc 1 59 2e-30 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000149526
SMART Domains Protein: ENSMUSP00000122231
Gene: ENSMUSG00000020289

DomainStartEndE-ValueType
Pfam:NPR3 8 72 2.7e-14 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The function of the encoded protein is not known. [provided by RefSeq, Aug 2011]
PHENOTYPE: This gene is deleted in the Hbath-J mutation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik A T 2: 68,728,995 Q184L probably benign Het
9030624G23Rik T G 12: 24,074,673 S68R possibly damaging Het
Acyp1 G T 12: 85,279,058 R56S unknown Het
Angpt2 C T 8: 18,692,064 R492Q probably damaging Het
Ankrd36 T C 11: 5,687,451 L1340P possibly damaging Het
Arhgef33 G C 17: 80,347,120 probably null Het
Bach1 G A 16: 87,729,633 S661N probably benign Het
Bik T C 15: 83,541,334 I12T possibly damaging Het
C3 C T 17: 57,218,859 R841H probably damaging Het
Cacna1s G T 1: 136,069,018 R119L probably damaging Het
Cic G A 7: 25,288,782 V1632M probably damaging Het
Ctif CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC 18: 75,471,803 probably benign Het
Dchs2 A G 3: 83,128,057 H37R possibly damaging Het
Dvl1 A G 4: 155,856,239 I439V possibly damaging Het
Fam19a1 T C 6: 96,115,756 probably null Het
Fat1 G A 8: 44,951,633 D474N probably damaging Het
Foxs1 T A 2: 152,933,108 E8D probably benign Het
Garnl3 T C 2: 32,992,257 D822G probably damaging Het
Gm11397 A T 13: 33,397,858 I133L probably damaging Het
Gm11756 C T 4: 73,919,862 S29N possibly damaging Het
Gm44501 C T 17: 40,578,829 A78V possibly damaging Het
Gpr19 C A 6: 134,869,392 A443S probably damaging Het
Helb T C 10: 120,095,102 R729G probably null Het
Lnpep G T 17: 17,538,562 T840K probably benign Het
Mctp2 T C 7: 72,185,796 N551S probably benign Het
Mgam T G 6: 40,668,193 F635V probably damaging Het
Mlc1 G A 15: 88,964,170 A262V probably damaging Het
Muc5b A G 7: 141,862,239 Y2974C probably benign Het
Olfr1090 A T 2: 86,754,093 L215Q probably damaging Het
Olfr136 C T 17: 38,335,394 P79L probably benign Het
Pkn2 A G 3: 142,794,107 F915S probably damaging Het
Pkn3 G A 2: 30,090,584 C829Y probably benign Het
Polr1a C T 6: 71,941,512 P685S probably damaging Het
Ppp4r3b A G 11: 29,173,352 D16G probably benign Het
Ppwd1 C T 13: 104,217,206 R348H probably damaging Het
Pxdc1 T C 13: 34,639,063 T98A probably benign Het
Rhbdl1 T C 17: 25,836,193 I68V probably benign Het
Ror2 A G 13: 53,117,225 C365R probably damaging Het
Samd4b A T 7: 28,403,903 H43Q probably damaging Het
Sbf2 A T 7: 110,441,426 V398D probably benign Het
Sbno2 T C 10: 80,058,874 I1012M probably damaging Het
Strn T C 17: 78,677,372 T281A probably benign Het
Syt4 T A 18: 31,444,265 D12V probably benign Het
Tmem45a A G 16: 56,825,737 L40P probably damaging Het
Tnn G A 1: 160,114,685 P1081L probably damaging Het
Unc80 T C 1: 66,677,385 V2888A probably benign Het
Other mutations in Nprl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02410:Nprl3 APN 11 32267539 start codon destroyed probably null 0.99
IGL03055:Nprl3 APN 11 32248230 intron probably benign
IGL03366:Nprl3 APN 11 32250256 missense probably damaging 1.00
R0114:Nprl3 UTSW 11 32239784 unclassified probably benign
R0555:Nprl3 UTSW 11 32233118 critical splice acceptor site probably null
R0620:Nprl3 UTSW 11 32234876 missense probably damaging 1.00
R2008:Nprl3 UTSW 11 32232973 missense probably damaging 0.97
R2172:Nprl3 UTSW 11 32234894 missense probably benign 0.00
R2884:Nprl3 UTSW 11 32248163 missense probably damaging 1.00
R3713:Nprl3 UTSW 11 32255464 missense probably damaging 0.98
R3836:Nprl3 UTSW 11 32233082 missense probably damaging 1.00
R4354:Nprl3 UTSW 11 32234906 missense probably benign 0.00
R6052:Nprl3 UTSW 11 32255453 missense possibly damaging 0.92
R6056:Nprl3 UTSW 11 32267432 missense probably damaging 0.98
R6307:Nprl3 UTSW 11 32239828 missense probably damaging 1.00
R6553:Nprl3 UTSW 11 32234812 missense probably benign
R6585:Nprl3 UTSW 11 32234812 missense probably benign
R6774:Nprl3 UTSW 11 32237381 missense probably damaging 1.00
R6806:Nprl3 UTSW 11 32267509 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGGTTTCCTGAAAAGTGGCC -3'
(R):5'- GATGATGACAAGGGATTTTCTGATG -3'

Sequencing Primer
(F):5'- GTGGCCACACAAGTGTCC -3'
(R):5'- GATTGTTCCTGTTCTGACTG -3'
Posted On2019-11-26