Incidental Mutation 'R7746:Ror2'
ID596855
Institutional Source Beutler Lab
Gene Symbol Ror2
Ensembl Gene ENSMUSG00000021464
Gene Namereceptor tyrosine kinase-like orphan receptor 2
SynonymsNtrkr2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7746 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location53109312-53286124 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 53117225 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 365 (C365R)
Ref Sequence ENSEMBL: ENSMUSP00000021918 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021918] [ENSMUST00000130235]
Predicted Effect probably damaging
Transcript: ENSMUST00000021918
AA Change: C365R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021918
Gene: ENSMUSG00000021464
AA Change: C365R

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
IGc2 74 142 5.23e-16 SMART
Pfam:Fz 174 294 1.2e-12 PFAM
KR 314 396 3.94e-45 SMART
transmembrane domain 403 425 N/A INTRINSIC
TyrKc 473 746 1.96e-113 SMART
low complexity region 765 783 N/A INTRINSIC
low complexity region 788 801 N/A INTRINSIC
low complexity region 839 859 N/A INTRINSIC
low complexity region 860 872 N/A INTRINSIC
low complexity region 905 924 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000130235
AA Change: C353R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123362
Gene: ENSMUSG00000021464
AA Change: C353R

DomainStartEndE-ValueType
IGc2 62 130 5.23e-16 SMART
Pfam:Fz 162 289 3.2e-26 PFAM
KR 302 384 3.94e-45 SMART
transmembrane domain 391 413 N/A INTRINSIC
TyrKc 461 734 1.96e-113 SMART
low complexity region 753 771 N/A INTRINSIC
low complexity region 776 789 N/A INTRINSIC
low complexity region 827 847 N/A INTRINSIC
low complexity region 848 860 N/A INTRINSIC
low complexity region 893 912 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a receptor protein tyrosine kinase and type I transmembrane protein that belongs to the ROR subfamily of cell surface receptors. The protein may be involved in the early formation of the chondrocytes and may be required for cartilage and growth plate development. Mutations in this gene can cause brachydactyly type B, a skeletal disorder characterized by hypoplasia/aplasia of distal phalanges and nails. In addition, mutations in this gene can cause the autosomal recessive form of Robinow syndrome, which is characterized by skeletal dysplasia with generalized limb bone shortening, segmental defects of the spine, brachydactyly, and a dysmorphic facial appearance. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for some disruptions in this gene die within the first few hours after birth. They display respiratory and cardiovascular abnormalities as well as a variety of skeletal defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik A T 2: 68,728,995 Q184L probably benign Het
9030624G23Rik T G 12: 24,074,673 S68R possibly damaging Het
Acyp1 G T 12: 85,279,058 R56S unknown Het
Angpt2 C T 8: 18,692,064 R492Q probably damaging Het
Ankrd36 T C 11: 5,687,451 L1340P possibly damaging Het
Arhgef33 G C 17: 80,347,120 probably null Het
Bach1 G A 16: 87,729,633 S661N probably benign Het
Bik T C 15: 83,541,334 I12T possibly damaging Het
C3 C T 17: 57,218,859 R841H probably damaging Het
Cacna1s G T 1: 136,069,018 R119L probably damaging Het
Cic G A 7: 25,288,782 V1632M probably damaging Het
Ctif CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC 18: 75,471,803 probably benign Het
Dchs2 A G 3: 83,128,057 H37R possibly damaging Het
Dvl1 A G 4: 155,856,239 I439V possibly damaging Het
Fam19a1 T C 6: 96,115,756 probably null Het
Fat1 G A 8: 44,951,633 D474N probably damaging Het
Foxs1 T A 2: 152,933,108 E8D probably benign Het
Garnl3 T C 2: 32,992,257 D822G probably damaging Het
Gm11397 A T 13: 33,397,858 I133L probably damaging Het
Gm11756 C T 4: 73,919,862 S29N possibly damaging Het
Gm44501 C T 17: 40,578,829 A78V possibly damaging Het
Gpr19 C A 6: 134,869,392 A443S probably damaging Het
Helb T C 10: 120,095,102 R729G probably null Het
Lnpep G T 17: 17,538,562 T840K probably benign Het
Mctp2 T C 7: 72,185,796 N551S probably benign Het
Mgam T G 6: 40,668,193 F635V probably damaging Het
Mlc1 G A 15: 88,964,170 A262V probably damaging Het
Muc5b A G 7: 141,862,239 Y2974C probably benign Het
Nprl3 A T 11: 32,248,150 Y208* probably null Het
Olfr1090 A T 2: 86,754,093 L215Q probably damaging Het
Olfr136 C T 17: 38,335,394 P79L probably benign Het
Pkn2 A G 3: 142,794,107 F915S probably damaging Het
Pkn3 G A 2: 30,090,584 C829Y probably benign Het
Polr1a C T 6: 71,941,512 P685S probably damaging Het
Ppp4r3b A G 11: 29,173,352 D16G probably benign Het
Ppwd1 C T 13: 104,217,206 R348H probably damaging Het
Pxdc1 T C 13: 34,639,063 T98A probably benign Het
Rhbdl1 T C 17: 25,836,193 I68V probably benign Het
Samd4b A T 7: 28,403,903 H43Q probably damaging Het
Sbf2 A T 7: 110,441,426 V398D probably benign Het
Sbno2 T C 10: 80,058,874 I1012M probably damaging Het
Strn T C 17: 78,677,372 T281A probably benign Het
Syt4 T A 18: 31,444,265 D12V probably benign Het
Tmem45a A G 16: 56,825,737 L40P probably damaging Het
Tnn G A 1: 160,114,685 P1081L probably damaging Het
Unc80 T C 1: 66,677,385 V2888A probably benign Het
Other mutations in Ror2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Ror2 APN 13 53113082 missense probably benign 0.01
IGL01523:Ror2 APN 13 53118963 missense probably benign 0.02
IGL01599:Ror2 APN 13 53111617 missense probably damaging 1.00
IGL01669:Ror2 APN 13 53111088 missense probably damaging 1.00
IGL02016:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02138:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02139:Ror2 APN 13 53111164 missense probably damaging 1.00
IGL02172:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02173:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02176:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02177:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02178:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02179:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02182:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02189:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02190:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02203:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02230:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02231:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02234:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02423:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02424:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02478:Ror2 APN 13 53121667 missense probably damaging 1.00
IGL02479:Ror2 APN 13 53131932 missense possibly damaging 0.62
IGL02517:Ror2 APN 13 53118840 missense probably damaging 1.00
IGL02554:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02618:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02619:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02622:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02623:Ror2 APN 13 53110728 missense probably damaging 1.00
lavage UTSW 13 53118982 missense probably damaging 1.00
willowy UTSW 13 53131919 missense probably damaging 1.00
R0076:Ror2 UTSW 13 53113074 missense probably benign 0.02
R0375:Ror2 UTSW 13 53132004 missense probably damaging 1.00
R0826:Ror2 UTSW 13 53113217 missense probably damaging 1.00
R1823:Ror2 UTSW 13 53110305 missense probably benign 0.07
R1895:Ror2 UTSW 13 53131849 missense probably damaging 1.00
R1946:Ror2 UTSW 13 53131849 missense probably damaging 1.00
R1983:Ror2 UTSW 13 53110408 missense probably benign 0.01
R2031:Ror2 UTSW 13 53117330 missense probably benign 0.01
R2197:Ror2 UTSW 13 53285780 critical splice donor site probably null
R2246:Ror2 UTSW 13 53111602 missense probably damaging 1.00
R2405:Ror2 UTSW 13 53130944 missense possibly damaging 0.67
R2411:Ror2 UTSW 13 53130944 missense possibly damaging 0.67
R2905:Ror2 UTSW 13 53131995 missense probably benign 0.01
R3156:Ror2 UTSW 13 53117364 missense probably damaging 0.98
R4198:Ror2 UTSW 13 53110644 missense probably benign 0.08
R4408:Ror2 UTSW 13 53118961 missense probably damaging 1.00
R4469:Ror2 UTSW 13 53131980 missense possibly damaging 0.87
R4648:Ror2 UTSW 13 53285500 nonsense probably null
R4705:Ror2 UTSW 13 53117297 missense probably benign 0.00
R4824:Ror2 UTSW 13 53110683 missense probably benign 0.10
R4831:Ror2 UTSW 13 53118844 missense probably damaging 0.97
R4951:Ror2 UTSW 13 53117147 missense probably benign 0.00
R4975:Ror2 UTSW 13 53131918 missense probably damaging 1.00
R5380:Ror2 UTSW 13 53117149 missense possibly damaging 0.73
R5469:Ror2 UTSW 13 53117339 missense probably benign 0.00
R5604:Ror2 UTSW 13 53117165 missense probably benign 0.01
R6188:Ror2 UTSW 13 53111311 missense probably damaging 0.98
R6221:Ror2 UTSW 13 53113217 missense probably damaging 1.00
R6243:Ror2 UTSW 13 53113080 missense probably benign
R6255:Ror2 UTSW 13 53110542 missense probably damaging 1.00
R6497:Ror2 UTSW 13 53131919 missense probably damaging 1.00
R6717:Ror2 UTSW 13 53118982 missense probably damaging 1.00
R6918:Ror2 UTSW 13 53111451 missense probably damaging 0.96
R7092:Ror2 UTSW 13 53110236 missense probably benign
R7134:Ror2 UTSW 13 53146706 missense probably benign 0.00
R7254:Ror2 UTSW 13 53118720 missense possibly damaging 0.72
R7517:Ror2 UTSW 13 53110865 missense possibly damaging 0.86
R7560:Ror2 UTSW 13 53110813 missense probably benign 0.05
R8031:Ror2 UTSW 13 53113157 missense probably damaging 1.00
R8479:Ror2 UTSW 13 53117364 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AATGCTTCTGTGGTAAGATGGGAC -3'
(R):5'- ATGCTCAGGCCGATAACTTTC -3'

Sequencing Primer
(F):5'- TGGGACACAAGAGCTCCTC -3'
(R):5'- CAGGCCGATAACTTTCTGTTTC -3'
Posted On2019-11-26