Incidental Mutation 'R7746:Ppwd1'
ID596856
Institutional Source Beutler Lab
Gene Symbol Ppwd1
Ensembl Gene ENSMUSG00000021713
Gene Namepeptidylprolyl isomerase domain and WD repeat containing 1
Synonyms4632422M10Rik, A330090G21Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.964) question?
Stock #R7746 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location104205124-104228843 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 104217206 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 348 (R348H)
Ref Sequence ENSEMBL: ENSMUSP00000022226 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022226]
Predicted Effect probably damaging
Transcript: ENSMUST00000022226
AA Change: R348H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022226
Gene: ENSMUSG00000021713
AA Change: R348H

DomainStartEndE-ValueType
WD40 80 117 2.96e-2 SMART
WD40 122 161 8.49e-3 SMART
Blast:WD40 164 207 9e-6 BLAST
WD40 211 251 2.76e0 SMART
WD40 269 308 1.4e-3 SMART
Blast:WD40 343 382 2e-6 BLAST
Blast:WD40 433 460 3e-7 BLAST
Pfam:Pro_isomerase 493 645 1.9e-52 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik A T 2: 68,728,995 Q184L probably benign Het
9030624G23Rik T G 12: 24,074,673 S68R possibly damaging Het
Acyp1 G T 12: 85,279,058 R56S unknown Het
Angpt2 C T 8: 18,692,064 R492Q probably damaging Het
Ankrd36 T C 11: 5,687,451 L1340P possibly damaging Het
Arhgef33 G C 17: 80,347,120 probably null Het
Bach1 G A 16: 87,729,633 S661N probably benign Het
Bik T C 15: 83,541,334 I12T possibly damaging Het
C3 C T 17: 57,218,859 R841H probably damaging Het
Cacna1s G T 1: 136,069,018 R119L probably damaging Het
Cic G A 7: 25,288,782 V1632M probably damaging Het
Ctif CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC 18: 75,471,803 probably benign Het
Dchs2 A G 3: 83,128,057 H37R possibly damaging Het
Dvl1 A G 4: 155,856,239 I439V possibly damaging Het
Fam19a1 T C 6: 96,115,756 probably null Het
Fat1 G A 8: 44,951,633 D474N probably damaging Het
Foxs1 T A 2: 152,933,108 E8D probably benign Het
Garnl3 T C 2: 32,992,257 D822G probably damaging Het
Gm11397 A T 13: 33,397,858 I133L probably damaging Het
Gm11756 C T 4: 73,919,862 S29N possibly damaging Het
Gm44501 C T 17: 40,578,829 A78V possibly damaging Het
Gpr19 C A 6: 134,869,392 A443S probably damaging Het
Helb T C 10: 120,095,102 R729G probably null Het
Lnpep G T 17: 17,538,562 T840K probably benign Het
Mctp2 T C 7: 72,185,796 N551S probably benign Het
Mgam T G 6: 40,668,193 F635V probably damaging Het
Mlc1 G A 15: 88,964,170 A262V probably damaging Het
Muc5b A G 7: 141,862,239 Y2974C probably benign Het
Nprl3 A T 11: 32,248,150 Y208* probably null Het
Olfr1090 A T 2: 86,754,093 L215Q probably damaging Het
Olfr136 C T 17: 38,335,394 P79L probably benign Het
Pkn2 A G 3: 142,794,107 F915S probably damaging Het
Pkn3 G A 2: 30,090,584 C829Y probably benign Het
Polr1a C T 6: 71,941,512 P685S probably damaging Het
Ppp4r3b A G 11: 29,173,352 D16G probably benign Het
Pxdc1 T C 13: 34,639,063 T98A probably benign Het
Rhbdl1 T C 17: 25,836,193 I68V probably benign Het
Ror2 A G 13: 53,117,225 C365R probably damaging Het
Samd4b A T 7: 28,403,903 H43Q probably damaging Het
Sbf2 A T 7: 110,441,426 V398D probably benign Het
Sbno2 T C 10: 80,058,874 I1012M probably damaging Het
Strn T C 17: 78,677,372 T281A probably benign Het
Syt4 T A 18: 31,444,265 D12V probably benign Het
Tmem45a A G 16: 56,825,737 L40P probably damaging Het
Tnn G A 1: 160,114,685 P1081L probably damaging Het
Unc80 T C 1: 66,677,385 V2888A probably benign Het
Other mutations in Ppwd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Ppwd1 APN 13 104217143 missense probably damaging 1.00
IGL01582:Ppwd1 APN 13 104213704 missense probably benign 0.01
IGL01697:Ppwd1 APN 13 104220464 missense probably benign 0.01
IGL01771:Ppwd1 APN 13 104217116 missense probably damaging 1.00
IGL02414:Ppwd1 APN 13 104223137 missense probably benign
IGL02803:Ppwd1 APN 13 104213684 missense probably benign 0.00
IGL02873:Ppwd1 APN 13 104209753 missense probably damaging 1.00
F5770:Ppwd1 UTSW 13 104220237 missense probably damaging 0.98
R0462:Ppwd1 UTSW 13 104222960 critical splice acceptor site probably null
R1638:Ppwd1 UTSW 13 104220263 missense probably damaging 1.00
R2211:Ppwd1 UTSW 13 104207142 missense probably benign 0.26
R2226:Ppwd1 UTSW 13 104217245 missense probably damaging 1.00
R2299:Ppwd1 UTSW 13 104220063 missense probably benign
R2353:Ppwd1 UTSW 13 104213582 missense probably benign
R2382:Ppwd1 UTSW 13 104207113 missense probably damaging 1.00
R3123:Ppwd1 UTSW 13 104213690 missense possibly damaging 0.90
R4521:Ppwd1 UTSW 13 104209659 missense probably benign 0.16
R4972:Ppwd1 UTSW 13 104220108 missense probably benign 0.00
R5125:Ppwd1 UTSW 13 104220435 missense probably benign 0.14
R5178:Ppwd1 UTSW 13 104220435 missense probably benign 0.14
R5468:Ppwd1 UTSW 13 104225444 missense possibly damaging 0.52
R5638:Ppwd1 UTSW 13 104220398 missense probably damaging 1.00
R6748:Ppwd1 UTSW 13 104208030 nonsense probably null
R7095:Ppwd1 UTSW 13 104205626 missense probably benign 0.21
R7201:Ppwd1 UTSW 13 104207172 missense probably damaging 1.00
R7206:Ppwd1 UTSW 13 104213598 missense probably damaging 0.99
R7664:Ppwd1 UTSW 13 104220290 missense probably damaging 1.00
V7580:Ppwd1 UTSW 13 104220237 missense probably damaging 0.98
V7581:Ppwd1 UTSW 13 104220237 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CCACTCTCTTTGGAGCAAACAAG -3'
(R):5'- CAACTTCTTACTGGCTCTCAATGTG -3'

Sequencing Primer
(F):5'- GGAGCAAACAAGACTCTCATTGTTC -3'
(R):5'- GTGTTCCTTTTCTATTTAGTGCTCAG -3'
Posted On2019-11-26