Incidental Mutation 'R7746:Bik'
ID596857
Institutional Source Beutler Lab
Gene Symbol Bik
Ensembl Gene ENSMUSG00000016758
Gene NameBCL2-interacting killer
SynonymsNbk, Biklk, Blk
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7746 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location83526862-83544634 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 83541334 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 12 (I12T)
Ref Sequence ENSEMBL: ENSMUSP00000016902 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016902] [ENSMUST00000229165] [ENSMUST00000229964] [ENSMUST00000230912]
Predicted Effect possibly damaging
Transcript: ENSMUST00000016902
AA Change: I12T

PolyPhen 2 Score 0.603 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000016902
Gene: ENSMUSG00000016758
AA Change: I12T

DomainStartEndE-ValueType
Pfam:bcl-2I13 1 149 1.5e-72 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000229165
AA Change: I12T

PolyPhen 2 Score 0.603 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect probably benign
Transcript: ENSMUST00000229964
Predicted Effect possibly damaging
Transcript: ENSMUST00000230912
AA Change: I12T

PolyPhen 2 Score 0.603 (Sensitivity: 0.87; Specificity: 0.91)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene shares a critical BH3 domain with other death-promoting proteins, such as BID, BAK, BAD and BAX, that is required for its pro-apoptotic activity, and for interaction with anti-apoptotic members of the BCL2 family, and viral survival-promoting proteins. Since the activity of this protein is suppressed in the presence of survival-promoting proteins, it is suggested as a likely target for anti-apoptotic proteins. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and grossly normal with no detectable changes in hematopoiesis, lymphocyte susceptibility to various apoptotic stimuli, or endothelial cell apoptosis in hyaloid vessel regression. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik A T 2: 68,728,995 Q184L probably benign Het
9030624G23Rik T G 12: 24,074,673 S68R possibly damaging Het
Acyp1 G T 12: 85,279,058 R56S unknown Het
Angpt2 C T 8: 18,692,064 R492Q probably damaging Het
Ankrd36 T C 11: 5,687,451 L1340P possibly damaging Het
Arhgef33 G C 17: 80,347,120 probably null Het
Bach1 G A 16: 87,729,633 S661N probably benign Het
C3 C T 17: 57,218,859 R841H probably damaging Het
Cacna1s G T 1: 136,069,018 R119L probably damaging Het
Cic G A 7: 25,288,782 V1632M probably damaging Het
Ctif CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC 18: 75,471,803 probably benign Het
Dchs2 A G 3: 83,128,057 H37R possibly damaging Het
Dvl1 A G 4: 155,856,239 I439V possibly damaging Het
Fam19a1 T C 6: 96,115,756 probably null Het
Fat1 G A 8: 44,951,633 D474N probably damaging Het
Foxs1 T A 2: 152,933,108 E8D probably benign Het
Garnl3 T C 2: 32,992,257 D822G probably damaging Het
Gm11397 A T 13: 33,397,858 I133L probably damaging Het
Gm11756 C T 4: 73,919,862 S29N possibly damaging Het
Gm44501 C T 17: 40,578,829 A78V possibly damaging Het
Gpr19 C A 6: 134,869,392 A443S probably damaging Het
Helb T C 10: 120,095,102 R729G probably null Het
Lnpep G T 17: 17,538,562 T840K probably benign Het
Mctp2 T C 7: 72,185,796 N551S probably benign Het
Mgam T G 6: 40,668,193 F635V probably damaging Het
Mlc1 G A 15: 88,964,170 A262V probably damaging Het
Muc5b A G 7: 141,862,239 Y2974C probably benign Het
Nprl3 A T 11: 32,248,150 Y208* probably null Het
Olfr1090 A T 2: 86,754,093 L215Q probably damaging Het
Olfr136 C T 17: 38,335,394 P79L probably benign Het
Pkn2 A G 3: 142,794,107 F915S probably damaging Het
Pkn3 G A 2: 30,090,584 C829Y probably benign Het
Polr1a C T 6: 71,941,512 P685S probably damaging Het
Ppp4r3b A G 11: 29,173,352 D16G probably benign Het
Ppwd1 C T 13: 104,217,206 R348H probably damaging Het
Pxdc1 T C 13: 34,639,063 T98A probably benign Het
Rhbdl1 T C 17: 25,836,193 I68V probably benign Het
Ror2 A G 13: 53,117,225 C365R probably damaging Het
Samd4b A T 7: 28,403,903 H43Q probably damaging Het
Sbf2 A T 7: 110,441,426 V398D probably benign Het
Sbno2 T C 10: 80,058,874 I1012M probably damaging Het
Strn T C 17: 78,677,372 T281A probably benign Het
Syt4 T A 18: 31,444,265 D12V probably benign Het
Tmem45a A G 16: 56,825,737 L40P probably damaging Het
Tnn G A 1: 160,114,685 P1081L probably damaging Het
Unc80 T C 1: 66,677,385 V2888A probably benign Het
Other mutations in Bik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2165:Bik UTSW 15 83541423 missense probably benign 0.00
R4568:Bik UTSW 15 83541444 critical splice donor site probably null
R5482:Bik UTSW 15 83544134 missense probably damaging 1.00
R6830:Bik UTSW 15 83544208 missense probably benign
R7270:Bik UTSW 15 83544163 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- CTGGATGGAAGCATCTCTGG -3'
(R):5'- CCACTCCTCTATATAGAAGGTGCTG -3'

Sequencing Primer
(F):5'- GGGTCAGGAACACTCATATACC -3'
(R):5'- TAGAAGGTGCTGTTCCAACC -3'
Posted On2019-11-26