Incidental Mutation 'R7746:Mlc1'
ID596858
Institutional Source Beutler Lab
Gene Symbol Mlc1
Ensembl Gene ENSMUSG00000035805
Gene Namemegalencephalic leukoencephalopathy with subcortical cysts 1 homolog (human)
SynonymsWKL1, Kiaa0027-hp
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7746 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location88955884-88979007 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 88964170 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 262 (A262V)
Ref Sequence ENSEMBL: ENSMUSP00000104993 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042594] [ENSMUST00000109368]
Predicted Effect probably damaging
Transcript: ENSMUST00000042594
AA Change: A256V

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000047667
Gene: ENSMUSG00000035805
AA Change: A256V

DomainStartEndE-ValueType
transmembrane domain 57 79 N/A INTRINSIC
transmembrane domain 119 141 N/A INTRINSIC
transmembrane domain 148 170 N/A INTRINSIC
transmembrane domain 203 225 N/A INTRINSIC
transmembrane domain 234 256 N/A INTRINSIC
transmembrane domain 266 288 N/A INTRINSIC
transmembrane domain 308 330 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109368
AA Change: A262V

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000104993
Gene: ENSMUSG00000035805
AA Change: A262V

DomainStartEndE-ValueType
transmembrane domain 63 85 N/A INTRINSIC
transmembrane domain 125 147 N/A INTRINSIC
transmembrane domain 154 176 N/A INTRINSIC
transmembrane domain 209 231 N/A INTRINSIC
transmembrane domain 240 262 N/A INTRINSIC
transmembrane domain 272 294 N/A INTRINSIC
transmembrane domain 314 336 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The function of this gene product is unknown; however, homology to other proteins suggests that it may be an integral membrane transporter. Mutations in this gene have been associated with megalencephalic leukoencephalopathy with subcortical cysts, an autosomal recessive neurological disorder. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit myelin vacuolization that progresses with age, and show alterations in glial cell and oligodendrocyte physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik A T 2: 68,728,995 Q184L probably benign Het
9030624G23Rik T G 12: 24,074,673 S68R possibly damaging Het
Acyp1 G T 12: 85,279,058 R56S unknown Het
Angpt2 C T 8: 18,692,064 R492Q probably damaging Het
Ankrd36 T C 11: 5,687,451 L1340P possibly damaging Het
Arhgef33 G C 17: 80,347,120 probably null Het
Bach1 G A 16: 87,729,633 S661N probably benign Het
Bik T C 15: 83,541,334 I12T possibly damaging Het
C3 C T 17: 57,218,859 R841H probably damaging Het
Cacna1s G T 1: 136,069,018 R119L probably damaging Het
Cic G A 7: 25,288,782 V1632M probably damaging Het
Ctif CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC 18: 75,471,803 probably benign Het
Dchs2 A G 3: 83,128,057 H37R possibly damaging Het
Dvl1 A G 4: 155,856,239 I439V possibly damaging Het
Fam19a1 T C 6: 96,115,756 probably null Het
Fat1 G A 8: 44,951,633 D474N probably damaging Het
Foxs1 T A 2: 152,933,108 E8D probably benign Het
Garnl3 T C 2: 32,992,257 D822G probably damaging Het
Gm11397 A T 13: 33,397,858 I133L probably damaging Het
Gm11756 C T 4: 73,919,862 S29N possibly damaging Het
Gm44501 C T 17: 40,578,829 A78V possibly damaging Het
Gpr19 C A 6: 134,869,392 A443S probably damaging Het
Helb T C 10: 120,095,102 R729G probably null Het
Lnpep G T 17: 17,538,562 T840K probably benign Het
Mctp2 T C 7: 72,185,796 N551S probably benign Het
Mgam T G 6: 40,668,193 F635V probably damaging Het
Muc5b A G 7: 141,862,239 Y2974C probably benign Het
Nprl3 A T 11: 32,248,150 Y208* probably null Het
Olfr1090 A T 2: 86,754,093 L215Q probably damaging Het
Olfr136 C T 17: 38,335,394 P79L probably benign Het
Pkn2 A G 3: 142,794,107 F915S probably damaging Het
Pkn3 G A 2: 30,090,584 C829Y probably benign Het
Polr1a C T 6: 71,941,512 P685S probably damaging Het
Ppp4r3b A G 11: 29,173,352 D16G probably benign Het
Ppwd1 C T 13: 104,217,206 R348H probably damaging Het
Pxdc1 T C 13: 34,639,063 T98A probably benign Het
Rhbdl1 T C 17: 25,836,193 I68V probably benign Het
Ror2 A G 13: 53,117,225 C365R probably damaging Het
Samd4b A T 7: 28,403,903 H43Q probably damaging Het
Sbf2 A T 7: 110,441,426 V398D probably benign Het
Sbno2 T C 10: 80,058,874 I1012M probably damaging Het
Strn T C 17: 78,677,372 T281A probably benign Het
Syt4 T A 18: 31,444,265 D12V probably benign Het
Tmem45a A G 16: 56,825,737 L40P probably damaging Het
Tnn G A 1: 160,114,685 P1081L probably damaging Het
Unc80 T C 1: 66,677,385 V2888A probably benign Het
Other mutations in Mlc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01634:Mlc1 APN 15 88974718 splice site probably benign
IGL03251:Mlc1 APN 15 88974731 missense possibly damaging 0.88
R0710:Mlc1 UTSW 15 88977864 missense possibly damaging 0.88
R1037:Mlc1 UTSW 15 88965461 missense probably damaging 1.00
R1573:Mlc1 UTSW 15 88958147 missense probably damaging 1.00
R1994:Mlc1 UTSW 15 88974579 missense possibly damaging 0.50
R2121:Mlc1 UTSW 15 88963431 missense probably benign 0.22
R2302:Mlc1 UTSW 15 88965437 missense possibly damaging 0.63
R3110:Mlc1 UTSW 15 88965996 missense probably benign 0.00
R3112:Mlc1 UTSW 15 88965996 missense probably benign 0.00
R3117:Mlc1 UTSW 15 88976528 missense probably damaging 1.00
R4027:Mlc1 UTSW 15 88966494 missense probably benign 0.29
R4450:Mlc1 UTSW 15 88963490 missense probably benign 0.19
R4576:Mlc1 UTSW 15 88974537 missense probably damaging 1.00
R4697:Mlc1 UTSW 15 88974777 missense probably damaging 1.00
R4728:Mlc1 UTSW 15 88978031 intron probably null
R4910:Mlc1 UTSW 15 88958212 missense possibly damaging 0.94
R5618:Mlc1 UTSW 15 88974566 missense probably damaging 1.00
R7528:Mlc1 UTSW 15 88974507 missense possibly damaging 0.95
R7885:Mlc1 UTSW 15 88977904 missense probably benign 0.01
R7968:Mlc1 UTSW 15 88977904 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GACTTGCAAACCTAGTGTTCGG -3'
(R):5'- GCAGCTACCAAACCTGTGAG -3'

Sequencing Primer
(F):5'- TTCAGAAACATCTTGGCCACTGG -3'
(R):5'- CCTGTGAGAGGCTGTCATGAGC -3'
Posted On2019-11-26