Incidental Mutation 'R7746:Tmem45a'
ID596859
Institutional Source Beutler Lab
Gene Symbol Tmem45a
Ensembl Gene ENSMUSG00000022754
Gene Nametransmembrane protein 45a
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R7746 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location56805161-56886166 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 56825737 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 40 (L40P)
Ref Sequence ENSEMBL: ENSMUSP00000023435 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023435] [ENSMUST00000135672] [ENSMUST00000232373]
Predicted Effect probably damaging
Transcript: ENSMUST00000023435
AA Change: L40P

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000023435
Gene: ENSMUSG00000022754
AA Change: L40P

DomainStartEndE-ValueType
transmembrane domain 10 27 N/A INTRINSIC
transmembrane domain 51 73 N/A INTRINSIC
transmembrane domain 88 110 N/A INTRINSIC
Pfam:DUF716 119 239 8.9e-38 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000135672
AA Change: L40P

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000232373
AA Change: L40P

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik A T 2: 68,728,995 Q184L probably benign Het
9030624G23Rik T G 12: 24,074,673 S68R possibly damaging Het
Acyp1 G T 12: 85,279,058 R56S unknown Het
Angpt2 C T 8: 18,692,064 R492Q probably damaging Het
Ankrd36 T C 11: 5,687,451 L1340P possibly damaging Het
Arhgef33 G C 17: 80,347,120 probably null Het
Bach1 G A 16: 87,729,633 S661N probably benign Het
Bik T C 15: 83,541,334 I12T possibly damaging Het
C3 C T 17: 57,218,859 R841H probably damaging Het
Cacna1s G T 1: 136,069,018 R119L probably damaging Het
Cic G A 7: 25,288,782 V1632M probably damaging Het
Ctif CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC 18: 75,471,803 probably benign Het
Dchs2 A G 3: 83,128,057 H37R possibly damaging Het
Dvl1 A G 4: 155,856,239 I439V possibly damaging Het
Fam19a1 T C 6: 96,115,756 probably null Het
Fat1 G A 8: 44,951,633 D474N probably damaging Het
Foxs1 T A 2: 152,933,108 E8D probably benign Het
Garnl3 T C 2: 32,992,257 D822G probably damaging Het
Gm11397 A T 13: 33,397,858 I133L probably damaging Het
Gm11756 C T 4: 73,919,862 S29N possibly damaging Het
Gm44501 C T 17: 40,578,829 A78V possibly damaging Het
Gpr19 C A 6: 134,869,392 A443S probably damaging Het
Helb T C 10: 120,095,102 R729G probably null Het
Lnpep G T 17: 17,538,562 T840K probably benign Het
Mctp2 T C 7: 72,185,796 N551S probably benign Het
Mgam T G 6: 40,668,193 F635V probably damaging Het
Mlc1 G A 15: 88,964,170 A262V probably damaging Het
Muc5b A G 7: 141,862,239 Y2974C probably benign Het
Nprl3 A T 11: 32,248,150 Y208* probably null Het
Olfr1090 A T 2: 86,754,093 L215Q probably damaging Het
Olfr136 C T 17: 38,335,394 P79L probably benign Het
Pkn2 A G 3: 142,794,107 F915S probably damaging Het
Pkn3 G A 2: 30,090,584 C829Y probably benign Het
Polr1a C T 6: 71,941,512 P685S probably damaging Het
Ppp4r3b A G 11: 29,173,352 D16G probably benign Het
Ppwd1 C T 13: 104,217,206 R348H probably damaging Het
Pxdc1 T C 13: 34,639,063 T98A probably benign Het
Rhbdl1 T C 17: 25,836,193 I68V probably benign Het
Ror2 A G 13: 53,117,225 C365R probably damaging Het
Samd4b A T 7: 28,403,903 H43Q probably damaging Het
Sbf2 A T 7: 110,441,426 V398D probably benign Het
Sbno2 T C 10: 80,058,874 I1012M probably damaging Het
Strn T C 17: 78,677,372 T281A probably benign Het
Syt4 T A 18: 31,444,265 D12V probably benign Het
Tnn G A 1: 160,114,685 P1081L probably damaging Het
Unc80 T C 1: 66,677,385 V2888A probably benign Het
Other mutations in Tmem45a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01609:Tmem45a APN 16 56811565 missense probably benign 0.01
IGL03189:Tmem45a APN 16 56811573 nonsense probably null
R1481:Tmem45a UTSW 16 56811602 missense possibly damaging 0.62
R1698:Tmem45a UTSW 16 56823570 missense probably benign 0.10
R1748:Tmem45a UTSW 16 56822338 missense possibly damaging 0.94
R1759:Tmem45a UTSW 16 56822402 missense probably benign
R1921:Tmem45a UTSW 16 56822302 missense probably benign 0.11
R2277:Tmem45a UTSW 16 56823519 missense probably damaging 1.00
R2279:Tmem45a UTSW 16 56823519 missense probably damaging 1.00
R3899:Tmem45a UTSW 16 56806738 missense probably damaging 1.00
R4941:Tmem45a UTSW 16 56822289 missense possibly damaging 0.62
R5489:Tmem45a UTSW 16 56825711 unclassified probably null
R6914:Tmem45a UTSW 16 56825782 missense probably benign 0.00
R6942:Tmem45a UTSW 16 56825782 missense probably benign 0.00
R7064:Tmem45a UTSW 16 56822404 missense probably benign 0.00
R7197:Tmem45a UTSW 16 56811663 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTGTAATTGGGTTAAGTACTAAGCAAC -3'
(R):5'- CCACACAGCAGTAGATTTGGTG -3'

Sequencing Primer
(F):5'- GCTCATGAAATACTCAAAAGG -3'
(R):5'- CAGCAGTAGATTTGGTGGGGAC -3'
Posted On2019-11-26