Incidental Mutation 'R0632:Cp'
ID 59686
Institutional Source Beutler Lab
Gene Symbol Cp
Ensembl Gene ENSMUSG00000003617
Gene Name ceruloplasmin
Synonyms D3Ertd555e
MMRRC Submission 038821-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0632 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 20011218-20063309 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 20025246 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Glycine at position 402 (S402G)
Ref Sequence ENSEMBL: ENSMUSP00000103965 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003714] [ENSMUST00000091309] [ENSMUST00000108325] [ENSMUST00000108328] [ENSMUST00000108329]
AlphaFold Q61147
Predicted Effect probably null
Transcript: ENSMUST00000003714
AA Change: S402G

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000003714
Gene: ENSMUSG00000003617
AA Change: S402G

DomainStartEndE-ValueType
Pfam:Cu-oxidase_3 90 203 5.1e-8 PFAM
Pfam:Cu-oxidase 220 357 9.6e-11 PFAM
Pfam:Cu-oxidase_2 280 357 1.1e-7 PFAM
Pfam:Cu-oxidase_3 444 556 1.4e-7 PFAM
Blast:FA58C 598 673 3e-6 BLAST
Pfam:Cu-oxidase_3 789 897 2.3e-9 PFAM
Pfam:Cu-oxidase_2 927 1054 8.3e-18 PFAM
low complexity region 1067 1078 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000091309
AA Change: S402G

PolyPhen 2 Score 0.781 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000088857
Gene: ENSMUSG00000003617
AA Change: S402G

DomainStartEndE-ValueType
Pfam:Cu-oxidase_3 90 203 7.7e-8 PFAM
Pfam:Cu-oxidase 220 357 1.1e-11 PFAM
Pfam:Cu-oxidase_2 280 357 2e-7 PFAM
Pfam:Cu-oxidase_3 444 557 4.6e-7 PFAM
Blast:FA58C 599 674 2e-6 BLAST
Pfam:Cu-oxidase_3 790 898 3.4e-9 PFAM
Pfam:Cu-oxidase_2 928 1055 1.6e-17 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000108325
AA Change: S402G

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000103961
Gene: ENSMUSG00000003617
AA Change: S402G

DomainStartEndE-ValueType
Pfam:Cu-oxidase_3 90 203 4.9e-8 PFAM
Pfam:Cu-oxidase 220 357 9.3e-11 PFAM
Pfam:Cu-oxidase_2 280 357 1e-7 PFAM
Pfam:Cu-oxidase_3 444 556 1.4e-7 PFAM
Blast:FA58C 598 673 2e-6 BLAST
Pfam:Cu-oxidase_3 789 897 2.2e-9 PFAM
Pfam:Cu-oxidase_2 927 1054 8.1e-18 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000108328
AA Change: S402G

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000103964
Gene: ENSMUSG00000003617
AA Change: S402G

DomainStartEndE-ValueType
Pfam:Cu-oxidase_3 90 203 5.1e-8 PFAM
Pfam:Cu-oxidase 220 357 9.6e-11 PFAM
Pfam:Cu-oxidase_2 280 357 1.1e-7 PFAM
Pfam:Cu-oxidase_3 444 556 1.4e-7 PFAM
Blast:FA58C 598 673 3e-6 BLAST
Pfam:Cu-oxidase_3 789 897 2.3e-9 PFAM
Pfam:Cu-oxidase_2 927 1054 8.3e-18 PFAM
low complexity region 1067 1078 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000108329
AA Change: S402G

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000103965
Gene: ENSMUSG00000003617
AA Change: S402G

DomainStartEndE-ValueType
Pfam:Cu-oxidase_3 89 203 8.7e-8 PFAM
Pfam:Cu-oxidase 220 357 7.8e-12 PFAM
Pfam:Cu-oxidase_2 242 356 2.1e-7 PFAM
Pfam:Cu-oxidase_3 445 555 4.4e-7 PFAM
Blast:FA58C 599 674 3e-6 BLAST
Pfam:Cu-oxidase_3 793 898 6.1e-9 PFAM
Pfam:Cu-oxidase_2 931 1055 5.2e-18 PFAM
low complexity region 1068 1079 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125994
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128615
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131454
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150264
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174803
Meta Mutation Damage Score 0.2440 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.0%
Validation Efficiency 95% (81/85)
MGI Phenotype FUNCTION: The protein encoded by this gene is a copper-containing glycoprotein found soluble in the serum and GPI-anchored in other tissues. It oxidizes Fe(II) to Fe(III) and is proposed to play an important role in iron homeostasis. In humans mutations of this gene cause aceruloplasminemia, which is characterized by retinal degeneration, diabetes, anemia and neurological symptoms. In mouse deficiency of this gene in combination with a deficiency of its homolog hephaestin causes retinal degeneration and serves as a pathophysiological model for aceruloplasminemia and age-related macular degeneration. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jan 2013]
PHENOTYPE: Homozygotes for targeted null mutations exhibit progressive accumulation of stored iron in the liver, spleen, cerebellum, and brainstem, mild iron deficiency anemia, and impaired motor coordination associated with loss of brainstem dopaminergic neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaa1a T A 9: 119,176,884 (GRCm39) probably benign Het
Adgrg7 T A 16: 56,562,952 (GRCm39) T462S possibly damaging Het
Akap6 A T 12: 52,983,931 (GRCm39) N825I probably damaging Het
Ankib1 T A 5: 3,822,529 (GRCm39) N59I probably benign Het
Anks6 T C 4: 47,033,167 (GRCm39) S633G possibly damaging Het
Ap4e1 C A 2: 126,891,200 (GRCm39) Y522* probably null Het
Art5 G A 7: 101,747,164 (GRCm39) T205I probably damaging Het
Ascc2 T A 11: 4,599,855 (GRCm39) L176H probably damaging Het
Atp13a5 T C 16: 29,117,026 (GRCm39) D529G probably benign Het
C2cd4a T C 9: 67,738,845 (GRCm39) E66G probably benign Het
C8a T C 4: 104,713,689 (GRCm39) D147G probably damaging Het
Ccdc14 T C 16: 34,542,019 (GRCm39) V532A possibly damaging Het
Ccdc88a T A 11: 29,432,749 (GRCm39) probably benign Het
Cfap54 C T 10: 92,720,958 (GRCm39) E2543K unknown Het
Cldn13 C T 5: 134,943,601 (GRCm39) E195K probably benign Het
Cpa3 T C 3: 20,279,358 (GRCm39) T194A probably benign Het
Crygf C A 1: 65,967,156 (GRCm39) Y93* probably null Het
Ctsh A G 9: 89,943,635 (GRCm39) R87G possibly damaging Het
Cyp2t4 A G 7: 26,857,671 (GRCm39) D428G possibly damaging Het
Dnah17 C G 11: 117,958,508 (GRCm39) probably benign Het
Dnah3 A G 7: 119,567,128 (GRCm39) V2366A probably benign Het
Dscaml1 A T 9: 45,643,432 (GRCm39) I1284F probably benign Het
Dsg1c T C 18: 20,405,403 (GRCm39) probably benign Het
Dst G T 1: 34,310,494 (GRCm39) R4098L probably damaging Het
Efhb A G 17: 53,720,487 (GRCm39) probably benign Het
Epha7 A T 4: 28,821,104 (GRCm39) I90F probably damaging Het
Fam171a2 T A 11: 102,328,707 (GRCm39) D684V probably damaging Het
Fan1 A G 7: 64,012,947 (GRCm39) V665A possibly damaging Het
Fbn2 A G 18: 58,170,819 (GRCm39) C2191R probably damaging Het
Fkbp3 G A 12: 65,120,692 (GRCm39) A2V probably benign Het
G6pd2 A G 5: 61,967,514 (GRCm39) N430D probably benign Het
Gm13547 T A 2: 29,651,596 (GRCm39) D7E possibly damaging Het
H4c9 G T 13: 22,225,197 (GRCm39) Y99* probably null Het
Hdac5 A T 11: 102,096,638 (GRCm39) D260E probably damaging Het
Hsf2bp T C 17: 32,232,320 (GRCm39) E142G probably damaging Het
Igf1r C T 7: 67,814,903 (GRCm39) T268I probably damaging Het
Inava T C 1: 136,155,356 (GRCm39) D83G probably benign Het
Kcne3 C T 7: 99,833,646 (GRCm39) R88C probably damaging Het
Klk1b9 G T 7: 43,628,796 (GRCm39) G100V possibly damaging Het
Kmt2d G A 15: 98,751,462 (GRCm39) probably benign Het
Lama1 C T 17: 68,059,363 (GRCm39) probably benign Het
Lcp2 C T 11: 34,032,426 (GRCm39) P335S possibly damaging Het
Lrrk2 T A 15: 91,680,231 (GRCm39) N2047K probably damaging Het
Mcub T C 3: 129,712,375 (GRCm39) M167V probably benign Het
Mia2 T C 12: 59,182,929 (GRCm39) L36P probably damaging Het
Mmp13 G A 9: 7,274,032 (GRCm39) G169R probably damaging Het
Mmp13 A T 9: 7,282,077 (GRCm39) I460F possibly damaging Het
Msh4 A G 3: 153,602,532 (GRCm39) I232T probably damaging Het
Msra T A 14: 64,447,981 (GRCm39) M145L probably benign Het
Myo7a A T 7: 97,761,357 (GRCm39) probably benign Het
Nme8 A T 13: 19,842,206 (GRCm39) N422K probably damaging Het
Nol6 A T 4: 41,121,115 (GRCm39) F353I probably damaging Het
Nphp3 A G 9: 103,895,473 (GRCm39) K384E probably damaging Het
Or51h5 C T 7: 102,577,811 (GRCm39) probably null Het
Or52e15 A G 7: 104,645,910 (GRCm39) I67T probably benign Het
Or52h7 A G 7: 104,213,544 (GRCm39) I39V probably benign Het
Phox2b T G 5: 67,253,557 (GRCm39) probably benign Het
Plec A T 15: 76,057,611 (GRCm39) S4131T probably damaging Het
Pptc7 G A 5: 122,451,654 (GRCm39) probably benign Het
Pramel31 G A 4: 144,090,352 (GRCm39) C464Y probably damaging Het
Prpf40b A G 15: 99,214,170 (GRCm39) E810G probably benign Het
Ptprc C T 1: 138,001,348 (GRCm39) V965I probably benign Het
Pum1 T A 4: 130,455,415 (GRCm39) M180K probably benign Het
Ranbp3 T C 17: 57,009,896 (GRCm39) probably benign Het
Rasgrf2 A G 13: 92,120,393 (GRCm39) S787P probably benign Het
Rnf19b T A 4: 128,967,344 (GRCm39) N294K probably damaging Het
Samd3 A T 10: 26,120,393 (GRCm39) H156L possibly damaging Het
Serpinb6c C T 13: 34,064,014 (GRCm39) R347Q possibly damaging Het
Slc36a3 A G 11: 55,015,906 (GRCm39) I416T probably damaging Het
Slc4a4 T A 5: 89,277,500 (GRCm39) F279Y probably damaging Het
Slc6a2 T A 8: 93,719,429 (GRCm39) probably benign Het
Snrnp40 C G 4: 130,271,836 (GRCm39) probably null Het
Tab2 A G 10: 7,795,565 (GRCm39) S232P probably benign Het
Tacc2 A T 7: 130,227,325 (GRCm39) K1356* probably null Het
Tmem87a A G 2: 120,190,023 (GRCm39) S544P probably damaging Het
Trim52 T A 14: 106,344,401 (GRCm39) C20S probably damaging Het
Usp38 A T 8: 81,740,779 (GRCm39) V96E probably benign Het
Vmn2r59 T C 7: 41,708,308 (GRCm39) Y33C probably damaging Het
Vsig10l T G 7: 43,113,561 (GRCm39) V171G probably damaging Het
Zfp957 T A 14: 79,450,360 (GRCm39) I480F probably damaging Het
Other mutations in Cp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Cp APN 3 20,039,826 (GRCm39) missense possibly damaging 0.95
IGL00923:Cp APN 3 20,024,165 (GRCm39) missense probably damaging 1.00
IGL01302:Cp APN 3 20,020,531 (GRCm39) missense probably damaging 0.99
IGL01407:Cp APN 3 20,031,369 (GRCm39) missense possibly damaging 0.79
IGL01505:Cp APN 3 20,031,356 (GRCm39) missense possibly damaging 0.83
IGL01677:Cp APN 3 20,020,598 (GRCm39) missense probably damaging 1.00
IGL02013:Cp APN 3 20,042,213 (GRCm39) missense probably damaging 1.00
IGL02114:Cp APN 3 20,020,511 (GRCm39) missense probably benign 0.16
IGL02950:Cp APN 3 20,042,165 (GRCm39) missense probably damaging 0.99
IGL03330:Cp APN 3 20,020,599 (GRCm39) missense probably damaging 1.00
iron10 UTSW 3 20,043,311 (GRCm39) unclassified probably benign
R0008:Cp UTSW 3 20,022,287 (GRCm39) missense probably damaging 1.00
R0008:Cp UTSW 3 20,022,287 (GRCm39) missense probably damaging 1.00
R0320:Cp UTSW 3 20,029,012 (GRCm39) splice site probably benign
R1103:Cp UTSW 3 20,036,149 (GRCm39) missense possibly damaging 0.82
R1137:Cp UTSW 3 20,033,116 (GRCm39) missense probably benign 0.04
R1199:Cp UTSW 3 20,031,316 (GRCm39) missense probably damaging 1.00
R1523:Cp UTSW 3 20,043,229 (GRCm39) missense probably benign 0.00
R1629:Cp UTSW 3 20,020,614 (GRCm39) critical splice donor site probably null
R1678:Cp UTSW 3 20,026,881 (GRCm39) missense probably damaging 0.99
R1733:Cp UTSW 3 20,022,383 (GRCm39) splice site probably benign
R1779:Cp UTSW 3 20,011,549 (GRCm39) missense possibly damaging 0.91
R1816:Cp UTSW 3 20,022,384 (GRCm39) splice site probably benign
R1990:Cp UTSW 3 20,033,177 (GRCm39) missense probably damaging 1.00
R2014:Cp UTSW 3 20,041,598 (GRCm39) missense probably benign 0.00
R2179:Cp UTSW 3 20,042,151 (GRCm39) missense probably damaging 1.00
R2249:Cp UTSW 3 20,041,734 (GRCm39) missense probably damaging 1.00
R3440:Cp UTSW 3 20,029,121 (GRCm39) missense probably benign 0.02
R3441:Cp UTSW 3 20,029,121 (GRCm39) missense probably benign 0.02
R3886:Cp UTSW 3 20,043,275 (GRCm39) missense probably damaging 1.00
R3937:Cp UTSW 3 20,025,198 (GRCm39) missense probably damaging 1.00
R4387:Cp UTSW 3 20,031,366 (GRCm39) missense probably damaging 1.00
R4412:Cp UTSW 3 20,020,517 (GRCm39) missense probably damaging 1.00
R4413:Cp UTSW 3 20,020,517 (GRCm39) missense probably damaging 1.00
R4514:Cp UTSW 3 20,042,177 (GRCm39) missense probably damaging 0.99
R4578:Cp UTSW 3 20,028,052 (GRCm39) missense probably damaging 1.00
R4579:Cp UTSW 3 20,011,599 (GRCm39) splice site probably null
R4694:Cp UTSW 3 20,029,049 (GRCm39) missense probably benign 0.07
R4724:Cp UTSW 3 20,026,811 (GRCm39) missense probably benign 0.02
R4910:Cp UTSW 3 20,043,388 (GRCm39) unclassified probably benign
R4960:Cp UTSW 3 20,027,961 (GRCm39) missense probably damaging 0.96
R5043:Cp UTSW 3 20,028,081 (GRCm39) missense probably benign 0.00
R5063:Cp UTSW 3 20,043,379 (GRCm39) missense probably benign 0.27
R5294:Cp UTSW 3 20,020,480 (GRCm39) missense probably benign 0.00
R5382:Cp UTSW 3 20,033,089 (GRCm39) missense probably damaging 1.00
R5404:Cp UTSW 3 20,043,292 (GRCm39) missense possibly damaging 0.92
R5569:Cp UTSW 3 20,033,041 (GRCm39) missense probably damaging 1.00
R5789:Cp UTSW 3 20,011,454 (GRCm39) missense probably benign
R5943:Cp UTSW 3 20,018,470 (GRCm39) missense probably benign 0.11
R6492:Cp UTSW 3 20,036,186 (GRCm39) missense probably benign 0.20
R6540:Cp UTSW 3 20,018,693 (GRCm39) critical splice donor site probably null
R7007:Cp UTSW 3 20,024,137 (GRCm39) missense probably damaging 0.97
R7126:Cp UTSW 3 20,034,788 (GRCm39) missense probably damaging 1.00
R7136:Cp UTSW 3 20,039,822 (GRCm39) nonsense probably null
R7212:Cp UTSW 3 20,029,130 (GRCm39) missense probably damaging 1.00
R7269:Cp UTSW 3 20,037,641 (GRCm39) missense probably damaging 1.00
R7316:Cp UTSW 3 20,026,916 (GRCm39) missense probably damaging 1.00
R7336:Cp UTSW 3 20,018,696 (GRCm39) splice site probably null
R7361:Cp UTSW 3 20,018,470 (GRCm39) missense probably benign 0.11
R7578:Cp UTSW 3 20,043,262 (GRCm39) missense possibly damaging 0.65
R7593:Cp UTSW 3 20,020,494 (GRCm39) missense probably benign 0.00
R7782:Cp UTSW 3 20,029,223 (GRCm39) critical splice donor site probably null
R7858:Cp UTSW 3 20,025,219 (GRCm39) missense probably benign 0.05
R8246:Cp UTSW 3 20,029,186 (GRCm39) missense probably damaging 1.00
R8247:Cp UTSW 3 20,020,570 (GRCm39) missense possibly damaging 0.84
R8300:Cp UTSW 3 20,011,385 (GRCm39) start gained probably benign
R8507:Cp UTSW 3 20,025,193 (GRCm39) missense probably damaging 1.00
R8756:Cp UTSW 3 20,059,736 (GRCm39) critical splice donor site probably null
R8826:Cp UTSW 3 20,039,739 (GRCm39) missense probably damaging 1.00
R8875:Cp UTSW 3 20,027,994 (GRCm39) missense possibly damaging 0.94
R9018:Cp UTSW 3 20,043,316 (GRCm39) missense probably damaging 1.00
R9072:Cp UTSW 3 20,033,158 (GRCm39) missense possibly damaging 0.91
R9111:Cp UTSW 3 20,027,949 (GRCm39) missense probably damaging 1.00
R9439:Cp UTSW 3 20,046,671 (GRCm39) critical splice acceptor site probably null
R9443:Cp UTSW 3 20,033,083 (GRCm39) missense possibly damaging 0.84
R9460:Cp UTSW 3 20,018,566 (GRCm39) missense
R9733:Cp UTSW 3 20,033,126 (GRCm39) missense probably damaging 1.00
R9748:Cp UTSW 3 20,043,335 (GRCm39) missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- GGTTCGTGACTGTAACAAGCCCTC -3'
(R):5'- AGGCAAGTATTCTGTGAAGCAGTAGTG -3'

Sequencing Primer
(F):5'- TCGCCAGAGGATAATATCCAAG -3'
(R):5'- atagagagggaaggggaagg -3'
Posted On 2013-07-11