Incidental Mutation 'R7746:Arhgef33'
ID596867
Institutional Source Beutler Lab
Gene Symbol Arhgef33
Ensembl Gene ENSMUSG00000054901
Gene NameRho guanine nucleotide exchange factor (GEF) 33
SynonymsLOC381112, Gm941
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R7746 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location80307407-80400081 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) G to C at 80347120 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000063284 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068175] [ENSMUST00000068175] [ENSMUST00000223878] [ENSMUST00000223878] [ENSMUST00000224391] [ENSMUST00000224391]
Predicted Effect probably null
Transcript: ENSMUST00000068175
SMART Domains Protein: ENSMUSP00000063284
Gene: ENSMUSG00000054901

DomainStartEndE-ValueType
coiled coil region 64 128 N/A INTRINSIC
low complexity region 129 149 N/A INTRINSIC
Pfam:RhoGEF 277 446 4.7e-16 PFAM
low complexity region 455 473 N/A INTRINSIC
low complexity region 510 520 N/A INTRINSIC
low complexity region 620 629 N/A INTRINSIC
low complexity region 751 770 N/A INTRINSIC
low complexity region 823 834 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000068175
SMART Domains Protein: ENSMUSP00000063284
Gene: ENSMUSG00000054901

DomainStartEndE-ValueType
coiled coil region 64 128 N/A INTRINSIC
low complexity region 129 149 N/A INTRINSIC
Pfam:RhoGEF 277 446 4.7e-16 PFAM
low complexity region 455 473 N/A INTRINSIC
low complexity region 510 520 N/A INTRINSIC
low complexity region 620 629 N/A INTRINSIC
low complexity region 751 770 N/A INTRINSIC
low complexity region 823 834 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000223878
Predicted Effect probably null
Transcript: ENSMUST00000223878
Predicted Effect probably null
Transcript: ENSMUST00000224391
Predicted Effect probably null
Transcript: ENSMUST00000224391
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik A T 2: 68,728,995 Q184L probably benign Het
9030624G23Rik T G 12: 24,074,673 S68R possibly damaging Het
Acyp1 G T 12: 85,279,058 R56S unknown Het
Angpt2 C T 8: 18,692,064 R492Q probably damaging Het
Ankrd36 T C 11: 5,687,451 L1340P possibly damaging Het
Bach1 G A 16: 87,729,633 S661N probably benign Het
Bik T C 15: 83,541,334 I12T possibly damaging Het
C3 C T 17: 57,218,859 R841H probably damaging Het
Cacna1s G T 1: 136,069,018 R119L probably damaging Het
Cic G A 7: 25,288,782 V1632M probably damaging Het
Ctif CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC 18: 75,471,803 probably benign Het
Dchs2 A G 3: 83,128,057 H37R possibly damaging Het
Dvl1 A G 4: 155,856,239 I439V possibly damaging Het
Fam19a1 T C 6: 96,115,756 probably null Het
Fat1 G A 8: 44,951,633 D474N probably damaging Het
Foxs1 T A 2: 152,933,108 E8D probably benign Het
Garnl3 T C 2: 32,992,257 D822G probably damaging Het
Gm11397 A T 13: 33,397,858 I133L probably damaging Het
Gm11756 C T 4: 73,919,862 S29N possibly damaging Het
Gm44501 C T 17: 40,578,829 A78V possibly damaging Het
Gpr19 C A 6: 134,869,392 A443S probably damaging Het
Helb T C 10: 120,095,102 R729G probably null Het
Lnpep G T 17: 17,538,562 T840K probably benign Het
Mctp2 T C 7: 72,185,796 N551S probably benign Het
Mgam T G 6: 40,668,193 F635V probably damaging Het
Mlc1 G A 15: 88,964,170 A262V probably damaging Het
Muc5b A G 7: 141,862,239 Y2974C probably benign Het
Nprl3 A T 11: 32,248,150 Y208* probably null Het
Olfr1090 A T 2: 86,754,093 L215Q probably damaging Het
Olfr136 C T 17: 38,335,394 P79L probably benign Het
Pkn2 A G 3: 142,794,107 F915S probably damaging Het
Pkn3 G A 2: 30,090,584 C829Y probably benign Het
Polr1a C T 6: 71,941,512 P685S probably damaging Het
Ppp4r3b A G 11: 29,173,352 D16G probably benign Het
Ppwd1 C T 13: 104,217,206 R348H probably damaging Het
Pxdc1 T C 13: 34,639,063 T98A probably benign Het
Rhbdl1 T C 17: 25,836,193 I68V probably benign Het
Ror2 A G 13: 53,117,225 C365R probably damaging Het
Samd4b A T 7: 28,403,903 H43Q probably damaging Het
Sbf2 A T 7: 110,441,426 V398D probably benign Het
Sbno2 T C 10: 80,058,874 I1012M probably damaging Het
Strn T C 17: 78,677,372 T281A probably benign Het
Syt4 T A 18: 31,444,265 D12V probably benign Het
Tmem45a A G 16: 56,825,737 L40P probably damaging Het
Tnn G A 1: 160,114,685 P1081L probably damaging Het
Unc80 T C 1: 66,677,385 V2888A probably benign Het
Other mutations in Arhgef33
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00783:Arhgef33 APN 17 80368230 missense probably benign 0.33
IGL00784:Arhgef33 APN 17 80368230 missense probably benign 0.33
IGL01601:Arhgef33 APN 17 80347683 missense probably damaging 1.00
IGL01647:Arhgef33 APN 17 80365266 splice site probably benign
IGL02654:Arhgef33 APN 17 80370311 missense probably damaging 1.00
IGL02712:Arhgef33 APN 17 80360373 missense probably damaging 1.00
R0195:Arhgef33 UTSW 17 80381434 missense probably damaging 0.96
R0732:Arhgef33 UTSW 17 80381354 missense possibly damaging 0.90
R0834:Arhgef33 UTSW 17 80347597 splice site probably benign
R1144:Arhgef33 UTSW 17 80355044 missense probably benign
R1465:Arhgef33 UTSW 17 80367301 missense possibly damaging 0.88
R1465:Arhgef33 UTSW 17 80367301 missense possibly damaging 0.88
R1513:Arhgef33 UTSW 17 80371389 missense probably benign
R1680:Arhgef33 UTSW 17 80347651 missense probably damaging 0.96
R1696:Arhgef33 UTSW 17 80349506 missense probably damaging 1.00
R1775:Arhgef33 UTSW 17 80373743 missense probably benign 0.05
R2046:Arhgef33 UTSW 17 80373466 missense probably benign 0.08
R3933:Arhgef33 UTSW 17 80373320 missense probably benign 0.01
R4573:Arhgef33 UTSW 17 80365282 missense probably damaging 1.00
R5222:Arhgef33 UTSW 17 80337314 missense probably damaging 1.00
R5269:Arhgef33 UTSW 17 80370275 missense probably damaging 1.00
R5933:Arhgef33 UTSW 17 80337280 missense probably benign
R6460:Arhgef33 UTSW 17 80349589 splice site probably null
R7307:Arhgef33 UTSW 17 80347120 critical splice acceptor site probably null
R7594:Arhgef33 UTSW 17 80370305 missense probably damaging 1.00
R7895:Arhgef33 UTSW 17 80373485 missense probably benign 0.00
Z1177:Arhgef33 UTSW 17 80384230 missense unknown
Predicted Primers PCR Primer
(F):5'- CAAGCTTCAGTGCACACAGC -3'
(R):5'- TTCATCAGGGAAATAAGAGAGGCTC -3'

Sequencing Primer
(F):5'- ACCTCTGCCCTGGACGAATAG -3'
(R):5'- GGCTCCCACCTTGAAGTAGTTTAATG -3'
Posted On2019-11-26