Incidental Mutation 'R7746:Ctif'
ID596869
Institutional Source Beutler Lab
Gene Symbol Ctif
Ensembl Gene ENSMUSG00000052928
Gene NameCBP80/20-dependent translation initiation factor
SynonymsLOC269037, Gm672
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.120) question?
Stock #R7746 (G1)
Quality Score130.491
Status Not validated
Chromosome18
Chromosomal Location75431224-75697696 bp(-) (GRCm38)
Type of Mutationcritical splice donor site
DNA Base Change (assembly) CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC to CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC at 75471803 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000129974 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165559]
Predicted Effect probably benign
Transcript: ENSMUST00000165559
SMART Domains Protein: ENSMUSP00000129974
Gene: ENSMUSG00000052928

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
low complexity region 188 204 N/A INTRINSIC
low complexity region 347 360 N/A INTRINSIC
MIF4G 401 602 5.46e-35 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CTIF is a component of the CBP80 (NCBP1; MIM 600469)/CBP20 (NCBP2; MIM 605133) translation initiation complex that binds cotranscriptionally to the cap end of nascent mRNA. The CBP80/CBP20 complex is involved in a simultaneous editing and translation step that recognizes premature termination codons (PTCs) in mRNAs and directs PTC-containing mRNAs toward nonsense-mediated decay (NMD). On mRNAs without PTCs, the CBP80/CBP20 complex is replaced with cytoplasmic mRNA cap-binding proteins, including EIF4G (MIM 600495), and steady-state translation of the mRNAs resumes in the cytoplasm (Kim et al., 2009 [PubMed 19648179]).[supplied by OMIM, Dec 2009]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik A T 2: 68,728,995 Q184L probably benign Het
9030624G23Rik T G 12: 24,074,673 S68R possibly damaging Het
Acyp1 G T 12: 85,279,058 R56S unknown Het
Angpt2 C T 8: 18,692,064 R492Q probably damaging Het
Ankrd36 T C 11: 5,687,451 L1340P possibly damaging Het
Arhgef33 G C 17: 80,347,120 probably null Het
Bach1 G A 16: 87,729,633 S661N probably benign Het
Bik T C 15: 83,541,334 I12T possibly damaging Het
C3 C T 17: 57,218,859 R841H probably damaging Het
Cacna1s G T 1: 136,069,018 R119L probably damaging Het
Cic G A 7: 25,288,782 V1632M probably damaging Het
Dchs2 A G 3: 83,128,057 H37R possibly damaging Het
Dvl1 A G 4: 155,856,239 I439V possibly damaging Het
Fam19a1 T C 6: 96,115,756 probably null Het
Fat1 G A 8: 44,951,633 D474N probably damaging Het
Foxs1 T A 2: 152,933,108 E8D probably benign Het
Garnl3 T C 2: 32,992,257 D822G probably damaging Het
Gm11397 A T 13: 33,397,858 I133L probably damaging Het
Gm11756 C T 4: 73,919,862 S29N possibly damaging Het
Gm44501 C T 17: 40,578,829 A78V possibly damaging Het
Gpr19 C A 6: 134,869,392 A443S probably damaging Het
Helb T C 10: 120,095,102 R729G probably null Het
Lnpep G T 17: 17,538,562 T840K probably benign Het
Mctp2 T C 7: 72,185,796 N551S probably benign Het
Mgam T G 6: 40,668,193 F635V probably damaging Het
Mlc1 G A 15: 88,964,170 A262V probably damaging Het
Muc5b A G 7: 141,862,239 Y2974C probably benign Het
Nprl3 A T 11: 32,248,150 Y208* probably null Het
Olfr1090 A T 2: 86,754,093 L215Q probably damaging Het
Olfr136 C T 17: 38,335,394 P79L probably benign Het
Pkn2 A G 3: 142,794,107 F915S probably damaging Het
Pkn3 G A 2: 30,090,584 C829Y probably benign Het
Polr1a C T 6: 71,941,512 P685S probably damaging Het
Ppp4r3b A G 11: 29,173,352 D16G probably benign Het
Ppwd1 C T 13: 104,217,206 R348H probably damaging Het
Pxdc1 T C 13: 34,639,063 T98A probably benign Het
Rhbdl1 T C 17: 25,836,193 I68V probably benign Het
Ror2 A G 13: 53,117,225 C365R probably damaging Het
Samd4b A T 7: 28,403,903 H43Q probably damaging Het
Sbf2 A T 7: 110,441,426 V398D probably benign Het
Sbno2 T C 10: 80,058,874 I1012M probably damaging Het
Strn T C 17: 78,677,372 T281A probably benign Het
Syt4 T A 18: 31,444,265 D12V probably benign Het
Tmem45a A G 16: 56,825,737 L40P probably damaging Het
Tnn G A 1: 160,114,685 P1081L probably damaging Het
Unc80 T C 1: 66,677,385 V2888A probably benign Het
Other mutations in Ctif
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Ctif APN 18 75437176 missense possibly damaging 0.95
IGL01481:Ctif APN 18 75611784 splice site probably benign
IGL02299:Ctif APN 18 75637245 missense probably damaging 1.00
IGL02319:Ctif APN 18 75521873 splice site probably benign
IGL03130:Ctif APN 18 75521618 missense probably benign
R0304:Ctif UTSW 18 75521818 missense probably benign 0.09
R0730:Ctif UTSW 18 75565012 missense probably damaging 0.99
R0835:Ctif UTSW 18 75435336 missense probably damaging 1.00
R1226:Ctif UTSW 18 75521579 small deletion probably benign
R1302:Ctif UTSW 18 75521678 missense probably benign 0.22
R1549:Ctif UTSW 18 75565025 missense probably damaging 1.00
R1674:Ctif UTSW 18 75637180 missense probably benign 0.00
R1697:Ctif UTSW 18 75624305 splice site probably benign
R1848:Ctif UTSW 18 75519941 missense probably damaging 0.96
R2102:Ctif UTSW 18 75521381 missense probably benign
R3499:Ctif UTSW 18 75611757 missense possibly damaging 0.94
R3878:Ctif UTSW 18 75519977 missense probably damaging 0.96
R4157:Ctif UTSW 18 75435270 missense probably benign 0.42
R4168:Ctif UTSW 18 75637215 missense probably damaging 1.00
R4225:Ctif UTSW 18 75435237 missense probably benign 0.01
R4560:Ctif UTSW 18 75519881 missense probably damaging 1.00
R4822:Ctif UTSW 18 75521561 missense probably benign 0.01
R5176:Ctif UTSW 18 75637219 missense probably damaging 1.00
R5824:Ctif UTSW 18 75610678 missense possibly damaging 0.55
R6824:Ctif UTSW 18 75521711 missense probably damaging 1.00
R6934:Ctif UTSW 18 75435360 missense probably benign 0.07
R7014:Ctif UTSW 18 75437208 missense possibly damaging 0.82
R7115:Ctif UTSW 18 75471803 critical splice donor site probably benign
R7169:Ctif UTSW 18 75472016 missense probably damaging 0.99
R7187:Ctif UTSW 18 75637219 missense probably damaging 1.00
R7355:Ctif UTSW 18 75610685 missense probably damaging 0.98
R7402:Ctif UTSW 18 75611736 missense probably benign 0.18
R7451:Ctif UTSW 18 75519803 missense possibly damaging 0.82
R7648:Ctif UTSW 18 75637142 missense probably benign 0.04
R7671:Ctif UTSW 18 75472016 missense probably damaging 0.99
R7765:Ctif UTSW 18 75605644 missense probably damaging 1.00
R7805:Ctif UTSW 18 75471803 critical splice donor site probably benign
X0027:Ctif UTSW 18 75637263 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTATTTCTTAAGGCATGGGGAAG -3'
(R):5'- CTCCACAGAAGGACTTCACTG -3'

Sequencing Primer
(F):5'- CTTAAGGCATGGGGAAGTCATTC -3'
(R):5'- AAGGACTTCACTGTGCGG -3'
Posted On2019-11-26