Incidental Mutation 'R0632:Cpa3'
ID 59687
Institutional Source Beutler Lab
Gene Symbol Cpa3
Ensembl Gene ENSMUSG00000001865
Gene Name carboxypeptidase A3, mast cell
Synonyms mast cell carboxypeptidase A, MC-CPA, mMC-CPA
MMRRC Submission 038821-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0632 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 20269784-20296345 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 20279358 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 194 (T194A)
Ref Sequence ENSEMBL: ENSMUSP00000001921 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001921]
AlphaFold P15089
Predicted Effect probably benign
Transcript: ENSMUST00000001921
AA Change: T194A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000001921
Gene: ENSMUSG00000001865
AA Change: T194A

Pfam:Propep_M14 27 103 9.5e-21 PFAM
Zn_pept 119 400 3.77e-127 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184606
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191659
Meta Mutation Damage Score 0.1046 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.0%
Validation Efficiency 95% (81/85)
MGI Phenotype FUNCTION: This gene encodes a member of the carboxypeptidase A family of zinc metalloproteases and preproprotein that is proteolytically processed to generate a mature protein product. This product is released by mast cells and may be involved in the degradation of endogenous proteins and the inactivation of venom-associated peptides. Homozygous knockout mice for this gene exhibit impaired mast cell development. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygous null mice have immature peritoneal mast cells but normal mast cell functions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaa1a T A 9: 119,176,884 (GRCm39) probably benign Het
Adgrg7 T A 16: 56,562,952 (GRCm39) T462S possibly damaging Het
Akap6 A T 12: 52,983,931 (GRCm39) N825I probably damaging Het
Ankib1 T A 5: 3,822,529 (GRCm39) N59I probably benign Het
Anks6 T C 4: 47,033,167 (GRCm39) S633G possibly damaging Het
Ap4e1 C A 2: 126,891,200 (GRCm39) Y522* probably null Het
Art5 G A 7: 101,747,164 (GRCm39) T205I probably damaging Het
Ascc2 T A 11: 4,599,855 (GRCm39) L176H probably damaging Het
Atp13a5 T C 16: 29,117,026 (GRCm39) D529G probably benign Het
C2cd4a T C 9: 67,738,845 (GRCm39) E66G probably benign Het
C8a T C 4: 104,713,689 (GRCm39) D147G probably damaging Het
Ccdc14 T C 16: 34,542,019 (GRCm39) V532A possibly damaging Het
Ccdc88a T A 11: 29,432,749 (GRCm39) probably benign Het
Cfap54 C T 10: 92,720,958 (GRCm39) E2543K unknown Het
Cldn13 C T 5: 134,943,601 (GRCm39) E195K probably benign Het
Cp A G 3: 20,025,246 (GRCm39) S402G probably null Het
Crygf C A 1: 65,967,156 (GRCm39) Y93* probably null Het
Ctsh A G 9: 89,943,635 (GRCm39) R87G possibly damaging Het
Cyp2t4 A G 7: 26,857,671 (GRCm39) D428G possibly damaging Het
Dnah17 C G 11: 117,958,508 (GRCm39) probably benign Het
Dnah3 A G 7: 119,567,128 (GRCm39) V2366A probably benign Het
Dscaml1 A T 9: 45,643,432 (GRCm39) I1284F probably benign Het
Dsg1c T C 18: 20,405,403 (GRCm39) probably benign Het
Dst G T 1: 34,310,494 (GRCm39) R4098L probably damaging Het
Efhb A G 17: 53,720,487 (GRCm39) probably benign Het
Epha7 A T 4: 28,821,104 (GRCm39) I90F probably damaging Het
Fam171a2 T A 11: 102,328,707 (GRCm39) D684V probably damaging Het
Fan1 A G 7: 64,012,947 (GRCm39) V665A possibly damaging Het
Fbn2 A G 18: 58,170,819 (GRCm39) C2191R probably damaging Het
Fkbp3 G A 12: 65,120,692 (GRCm39) A2V probably benign Het
G6pd2 A G 5: 61,967,514 (GRCm39) N430D probably benign Het
Gm13547 T A 2: 29,651,596 (GRCm39) D7E possibly damaging Het
H4c9 G T 13: 22,225,197 (GRCm39) Y99* probably null Het
Hdac5 A T 11: 102,096,638 (GRCm39) D260E probably damaging Het
Hsf2bp T C 17: 32,232,320 (GRCm39) E142G probably damaging Het
Igf1r C T 7: 67,814,903 (GRCm39) T268I probably damaging Het
Inava T C 1: 136,155,356 (GRCm39) D83G probably benign Het
Kcne3 C T 7: 99,833,646 (GRCm39) R88C probably damaging Het
Klk1b9 G T 7: 43,628,796 (GRCm39) G100V possibly damaging Het
Kmt2d G A 15: 98,751,462 (GRCm39) probably benign Het
Lama1 C T 17: 68,059,363 (GRCm39) probably benign Het
Lcp2 C T 11: 34,032,426 (GRCm39) P335S possibly damaging Het
Lrrk2 T A 15: 91,680,231 (GRCm39) N2047K probably damaging Het
Mcub T C 3: 129,712,375 (GRCm39) M167V probably benign Het
Mia2 T C 12: 59,182,929 (GRCm39) L36P probably damaging Het
Mmp13 G A 9: 7,274,032 (GRCm39) G169R probably damaging Het
Mmp13 A T 9: 7,282,077 (GRCm39) I460F possibly damaging Het
Msh4 A G 3: 153,602,532 (GRCm39) I232T probably damaging Het
Msra T A 14: 64,447,981 (GRCm39) M145L probably benign Het
Myo7a A T 7: 97,761,357 (GRCm39) probably benign Het
Nme8 A T 13: 19,842,206 (GRCm39) N422K probably damaging Het
Nol6 A T 4: 41,121,115 (GRCm39) F353I probably damaging Het
Nphp3 A G 9: 103,895,473 (GRCm39) K384E probably damaging Het
Or51h5 C T 7: 102,577,811 (GRCm39) probably null Het
Or52e15 A G 7: 104,645,910 (GRCm39) I67T probably benign Het
Or52h7 A G 7: 104,213,544 (GRCm39) I39V probably benign Het
Phox2b T G 5: 67,253,557 (GRCm39) probably benign Het
Plec A T 15: 76,057,611 (GRCm39) S4131T probably damaging Het
Pptc7 G A 5: 122,451,654 (GRCm39) probably benign Het
Pramel31 G A 4: 144,090,352 (GRCm39) C464Y probably damaging Het
Prpf40b A G 15: 99,214,170 (GRCm39) E810G probably benign Het
Ptprc C T 1: 138,001,348 (GRCm39) V965I probably benign Het
Pum1 T A 4: 130,455,415 (GRCm39) M180K probably benign Het
Ranbp3 T C 17: 57,009,896 (GRCm39) probably benign Het
Rasgrf2 A G 13: 92,120,393 (GRCm39) S787P probably benign Het
Rnf19b T A 4: 128,967,344 (GRCm39) N294K probably damaging Het
Samd3 A T 10: 26,120,393 (GRCm39) H156L possibly damaging Het
Serpinb6c C T 13: 34,064,014 (GRCm39) R347Q possibly damaging Het
Slc36a3 A G 11: 55,015,906 (GRCm39) I416T probably damaging Het
Slc4a4 T A 5: 89,277,500 (GRCm39) F279Y probably damaging Het
Slc6a2 T A 8: 93,719,429 (GRCm39) probably benign Het
Snrnp40 C G 4: 130,271,836 (GRCm39) probably null Het
Tab2 A G 10: 7,795,565 (GRCm39) S232P probably benign Het
Tacc2 A T 7: 130,227,325 (GRCm39) K1356* probably null Het
Tmem87a A G 2: 120,190,023 (GRCm39) S544P probably damaging Het
Trim52 T A 14: 106,344,401 (GRCm39) C20S probably damaging Het
Usp38 A T 8: 81,740,779 (GRCm39) V96E probably benign Het
Vmn2r59 T C 7: 41,708,308 (GRCm39) Y33C probably damaging Het
Vsig10l T G 7: 43,113,561 (GRCm39) V171G probably damaging Het
Zfp957 T A 14: 79,450,360 (GRCm39) I480F probably damaging Het
Other mutations in Cpa3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00943:Cpa3 APN 3 20,282,979 (GRCm39) missense possibly damaging 0.95
IGL02471:Cpa3 APN 3 20,282,971 (GRCm39) critical splice donor site probably null
IGL02605:Cpa3 APN 3 20,276,376 (GRCm39) missense probably benign 0.15
IGL03333:Cpa3 APN 3 20,269,992 (GRCm39) missense possibly damaging 0.52
IGL03351:Cpa3 APN 3 20,270,126 (GRCm39) missense probably benign
R0084:Cpa3 UTSW 3 20,296,265 (GRCm39) splice site probably benign
R1017:Cpa3 UTSW 3 20,293,797 (GRCm39) missense possibly damaging 0.86
R1334:Cpa3 UTSW 3 20,276,387 (GRCm39) missense probably damaging 1.00
R1796:Cpa3 UTSW 3 20,277,391 (GRCm39) splice site probably null
R2310:Cpa3 UTSW 3 20,281,387 (GRCm39) missense probably damaging 1.00
R3945:Cpa3 UTSW 3 20,279,281 (GRCm39) missense probably damaging 1.00
R4467:Cpa3 UTSW 3 20,282,981 (GRCm39) nonsense probably null
R4551:Cpa3 UTSW 3 20,273,934 (GRCm39) missense probably benign 0.37
R4927:Cpa3 UTSW 3 20,276,303 (GRCm39) missense probably damaging 1.00
R5159:Cpa3 UTSW 3 20,281,387 (GRCm39) missense probably damaging 1.00
R5307:Cpa3 UTSW 3 20,281,327 (GRCm39) critical splice donor site probably null
R5564:Cpa3 UTSW 3 20,296,307 (GRCm39) missense possibly damaging 0.84
R6477:Cpa3 UTSW 3 20,293,739 (GRCm39) missense possibly damaging 0.81
R7624:Cpa3 UTSW 3 20,279,307 (GRCm39) missense possibly damaging 0.86
R8279:Cpa3 UTSW 3 20,277,478 (GRCm39) missense possibly damaging 0.70
R8302:Cpa3 UTSW 3 20,276,316 (GRCm39) missense probably damaging 1.00
R8387:Cpa3 UTSW 3 20,281,400 (GRCm39) missense probably benign 0.05
R8418:Cpa3 UTSW 3 20,276,315 (GRCm39) missense probably damaging 1.00
R9383:Cpa3 UTSW 3 20,283,045 (GRCm39) missense probably benign 0.08
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- ggaagttggtgaagggaaatg -3'
Posted On 2013-07-11