Incidental Mutation 'R7747:Slco5a1'
ID596870
Institutional Source Beutler Lab
Gene Symbol Slco5a1
Ensembl Gene ENSMUSG00000025938
Gene Namesolute carrier organic anion transporter family, member 5A1
SynonymsA630033C23Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.215) question?
Stock #R7747 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location12866549-12992650 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 12990122 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 125 (V125A)
Ref Sequence ENSEMBL: ENSMUSP00000139533 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115402] [ENSMUST00000115403] [ENSMUST00000136197] [ENSMUST00000146763] [ENSMUST00000147606] [ENSMUST00000188454]
Predicted Effect probably benign
Transcript: ENSMUST00000115402
AA Change: V125A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000111061
Gene: ENSMUSG00000025938
AA Change: V125A

DomainStartEndE-ValueType
low complexity region 80 93 N/A INTRINSIC
Pfam:MFS_1 137 548 3e-28 PFAM
KAZAL 559 602 3.26e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115403
AA Change: V125A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000111062
Gene: ENSMUSG00000025938
AA Change: V125A

DomainStartEndE-ValueType
low complexity region 80 93 N/A INTRINSIC
Pfam:MFS_1 137 547 2.8e-28 PFAM
KAZAL 559 602 3.26e-2 SMART
transmembrane domain 737 759 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136197
AA Change: V125A

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000139533
Gene: ENSMUSG00000025938
AA Change: V125A

DomainStartEndE-ValueType
low complexity region 80 93 N/A INTRINSIC
Pfam:MFS_1 137 548 3.6e-27 PFAM
KAZAL 559 601 4.3e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000146763
AA Change: V125A

PolyPhen 2 Score 0.129 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000139586
Gene: ENSMUSG00000025938
AA Change: V125A

DomainStartEndE-ValueType
low complexity region 80 93 N/A INTRINSIC
Pfam:OATP 130 352 8.4e-72 PFAM
Pfam:MFS_1 137 332 1.6e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147606
AA Change: V125A

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000140658
Gene: ENSMUSG00000025938
AA Change: V125A

DomainStartEndE-ValueType
low complexity region 80 93 N/A INTRINSIC
Pfam:OATP 130 478 1.5e-105 PFAM
Pfam:MFS_1 137 476 2.3e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188454
AA Change: V125A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000140091
Gene: ENSMUSG00000025938
AA Change: V125A

DomainStartEndE-ValueType
low complexity region 80 93 N/A INTRINSIC
Pfam:MFS_1 137 548 4.1e-28 PFAM
KAZAL 559 602 3.26e-2 SMART
transmembrane domain 737 759 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (89/89)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a 12 transmembrane domain protein that is a member of the solute carrier organic anion transporter superfamily. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2009]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010109A12Rik G A 5: 93,206,557 probably null Het
2410004P03Rik C T 12: 17,007,148 S116N probably damaging Het
3425401B19Rik T C 14: 32,663,069 D313G possibly damaging Het
AA986860 A G 1: 130,743,547 E502G possibly damaging Het
Adamts20 T A 15: 94,291,587 K1462* probably null Het
Adgrg6 A C 10: 14,450,577 probably null Het
Ankrd13d G A 19: 4,280,985 H165Y probably damaging Het
Arap3 T C 18: 37,988,888 probably null Het
Arhgap33 A G 7: 30,524,135 V823A probably damaging Het
Aup1 C A 6: 83,054,795 P34T unknown Het
Bcl2l2 C T 14: 54,884,379 probably benign Het
Bicc1 T C 10: 70,946,993 T515A probably benign Het
Ccdc73 A C 2: 104,929,556 K106Q probably damaging Het
Celsr3 G A 9: 108,829,978 R1220Q possibly damaging Het
Cep290 C T 10: 100,558,176 Q2082* probably null Het
Cercam A G 2: 29,871,286 D104G probably benign Het
Champ1 A G 8: 13,879,990 H716R probably damaging Het
Cntrl A T 2: 35,116,798 I159F probably damaging Het
Col11a1 T C 3: 114,102,572 I507T unknown Het
Cped1 T C 6: 22,143,974 I573T probably damaging Het
Crot C T 5: 8,968,869 probably null Het
D1Pas1 T A 1: 186,968,677 S268T probably benign Het
Erich6 A G 3: 58,618,928 V551A probably damaging Het
Fbxo32 T C 15: 58,191,361 N192S probably damaging Het
Fgd6 T C 10: 94,044,916 V544A probably damaging Het
Fnbp1 C T 2: 31,036,147 G552E probably damaging Het
Gjb5 A T 4: 127,356,162 V63D probably damaging Het
Gm10053 T C 19: 24,876,039 I96T probably benign Het
Gm11639 T G 11: 104,842,603 I2011S probably damaging Het
Gm38119 T C 3: 92,738,021 S89G unknown Het
Gm884 A T 11: 103,614,255 S2296T probably damaging Het
Gpn2 A G 4: 133,586,045 I183V probably benign Het
Greb1 C T 12: 16,674,795 V1793M probably benign Het
H2-Q7 A G 17: 35,440,061 I163V probably benign Het
Hrh2 T C 13: 54,214,530 V175A possibly damaging Het
Hsd3b3 C T 3: 98,743,898 V79I possibly damaging Het
Itgb7 T C 15: 102,216,604 I727M possibly damaging Het
Kcnj16 T A 11: 111,024,743 F77Y probably damaging Het
Lilra6 T A 7: 3,912,996 Q288L probably benign Het
Malrd1 G A 2: 16,074,835 V1788M unknown Het
Mau2 T C 8: 70,026,723 I349V possibly damaging Het
Mbnl3 C T X: 51,130,334 R181H probably damaging Het
Mfsd6 T C 1: 52,676,547 T524A probably benign Het
Mical2 G T 7: 112,333,839 R740L probably benign Het
Mknk1 G A 4: 115,878,072 C379Y possibly damaging Het
Mta3 A T 17: 83,791,736 K410* probably null Het
Myb A C 10: 21,156,425 I19S possibly damaging Het
Ncor2 A G 5: 125,027,038 F996S Het
Nlrp1a T C 11: 71,123,408 M339V possibly damaging Het
Olfr136 C T 17: 38,335,394 P79L probably benign Het
Olfr689 A G 7: 105,314,447 K148E probably damaging Het
Pcdhga5 C T 18: 37,696,782 T761I possibly damaging Het
Pcmtd2 T C 2: 181,851,659 L219P possibly damaging Het
Pfdn1 C T 18: 36,432,305 probably null Het
Pkn3 G A 2: 30,090,584 C829Y probably benign Het
Pld1 T C 3: 28,087,189 S634P possibly damaging Het
Pofut2 T G 10: 77,262,470 V139G possibly damaging Het
Prdm12 C A 2: 31,653,871 probably null Het
Prkar2b C A 12: 32,060,938 A49S probably benign Het
Prmt1 A T 7: 44,984,136 probably null Het
Rab39 A T 9: 53,686,400 D188E probably benign Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Scgb1b19 A G 7: 33,287,498 I25V probably benign Het
Scn9a A T 2: 66,484,298 I1692N probably damaging Het
Sdk1 G T 5: 142,084,491 G1137V probably damaging Het
Sec16b A G 1: 157,565,472 T950A possibly damaging Het
Senp2 G T 16: 22,038,622 R398L probably damaging Het
Sfswap G T 5: 129,550,593 probably null Het
Sh3rf1 A G 8: 61,353,753 T362A probably damaging Het
Slc17a1 A T 13: 23,888,052 I418F probably benign Het
Slc1a4 A T 11: 20,308,587 M284K probably damaging Het
Slc5a2 A T 7: 128,266,395 probably null Het
Smu1 A G 4: 40,748,600 V230A probably benign Het
Sp4 A G 12: 118,254,404 probably null Het
Stbd1 A G 5: 92,605,557 K302R probably damaging Het
Stx2 A T 5: 128,986,417 V268D probably benign Het
Tbc1d9b G A 11: 50,161,620 A885T probably benign Het
Tbce T A 13: 14,006,478 D267V possibly damaging Het
Tert T C 13: 73,627,606 Y159H probably damaging Het
Thbs2 T A 17: 14,670,039 I1102F possibly damaging Het
Tmprss7 G C 16: 45,683,510 A183G probably benign Het
Top3b C A 16: 16,887,721 P450Q probably benign Het
Trpm6 A T 19: 18,750,045 probably null Het
Ube4a T C 9: 44,925,973 D988G probably damaging Het
Vmn1r158 A T 7: 22,790,300 S161R probably benign Het
Vps41 T C 13: 18,841,252 probably null Het
Zfp354c TCACACTCGGCACA TCACA 11: 50,815,240 probably benign Het
Zfp617 T A 8: 71,928,189 probably null Het
Zfp808 C T 13: 62,171,505 H183Y probably benign Het
Zfy1 A T Y: 725,496 C756* probably null Het
Zswim2 A T 2: 83,915,607 Y496N probably damaging Het
Other mutations in Slco5a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02264:Slco5a1 APN 1 12871995 missense probably benign 0.01
IGL02330:Slco5a1 APN 1 12939060 missense probably damaging 1.00
IGL02660:Slco5a1 APN 1 12989636 missense probably damaging 1.00
IGL02904:Slco5a1 APN 1 12921097 missense probably damaging 0.98
IGL02972:Slco5a1 APN 1 12990155 nonsense probably null
IGL03100:Slco5a1 APN 1 12879280 missense possibly damaging 0.67
IGL03270:Slco5a1 APN 1 12872028 missense probably benign
R0969:Slco5a1 UTSW 1 12989892 missense probably damaging 1.00
R1337:Slco5a1 UTSW 1 12939142 missense probably benign 0.01
R1434:Slco5a1 UTSW 1 12871908 missense probably benign 0.00
R1627:Slco5a1 UTSW 1 12990383 missense probably damaging 1.00
R1767:Slco5a1 UTSW 1 12989615 missense probably damaging 1.00
R1893:Slco5a1 UTSW 1 12894472 missense probably damaging 1.00
R1894:Slco5a1 UTSW 1 12872259 missense probably damaging 1.00
R2301:Slco5a1 UTSW 1 12879262 missense probably damaging 0.98
R2302:Slco5a1 UTSW 1 12879262 missense probably damaging 0.98
R2303:Slco5a1 UTSW 1 12879262 missense probably damaging 0.98
R2304:Slco5a1 UTSW 1 12879262 missense probably damaging 0.98
R2349:Slco5a1 UTSW 1 12921152 missense probably damaging 1.00
R2351:Slco5a1 UTSW 1 12989934 missense probably benign 0.05
R3079:Slco5a1 UTSW 1 12879262 missense probably damaging 0.98
R3949:Slco5a1 UTSW 1 12989609 missense probably damaging 1.00
R4197:Slco5a1 UTSW 1 12894516 missense probably damaging 1.00
R4380:Slco5a1 UTSW 1 12939168 missense probably damaging 0.96
R4532:Slco5a1 UTSW 1 12879223 missense probably damaging 1.00
R4750:Slco5a1 UTSW 1 12879280 missense probably damaging 1.00
R5891:Slco5a1 UTSW 1 12990402 missense probably benign 0.04
R6024:Slco5a1 UTSW 1 12944070 missense probably damaging 1.00
R6332:Slco5a1 UTSW 1 12921185 missense probably benign 0.27
R6492:Slco5a1 UTSW 1 12989927 missense probably damaging 1.00
R6860:Slco5a1 UTSW 1 12881196 intron probably benign
R6994:Slco5a1 UTSW 1 12881393 missense probably damaging 1.00
R7121:Slco5a1 UTSW 1 12990437 missense probably benign 0.00
R7802:Slco5a1 UTSW 1 12990476 missense possibly damaging 0.76
R7895:Slco5a1 UTSW 1 12989703 missense possibly damaging 0.52
R7984:Slco5a1 UTSW 1 12881384 missense probably damaging 1.00
R8172:Slco5a1 UTSW 1 12990266 nonsense probably null
R8536:Slco5a1 UTSW 1 12881301 missense possibly damaging 0.69
RF010:Slco5a1 UTSW 1 12871947 missense probably damaging 1.00
X0065:Slco5a1 UTSW 1 12872212 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCACCAGGTTTCCTATATCAAAGC -3'
(R):5'- CAGTGCTGGGAATGCAGATG -3'

Sequencing Primer
(F):5'- GGTTTCCTATATCAAAGCAGCTGACC -3'
(R):5'- TTGCAATGAAGCTCCAGGTC -3'
Posted On2019-11-26