Mutagenetix > Incidental Mutation

Incidental Mutation 'R7747:Cntrl'

596879

Institutional Source

Beutler Lab

Gene Symbol

Cntrl

Ensembl Gene

ENSMUSG00000057110

Gene Name

centriolin

Synonyms

6720467O09Rik, Cep110, IB3/5, Ma2a8, b2b1468Clo, Cep1

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.924) question?

Stock #

R7747 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

35109492-35178822 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 35116798 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 159 (I159F)

Ref Sequence

ENSEMBL: ENSMUSP00000028235 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028235] [ENSMUST00000028237] [ENSMUST00000113032] [ENSMUST00000156933]

AlphaFold

A2AL36

Predicted Effect

probably damaging
Transcript: ENSMUST00000028235
AA Change: I159F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000028235
Gene: ENSMUSG00000057110
AA Change: I159F

Domain	Start	End	E-Value	Type
low complexity region	21	38	N/A	INTRINSIC
LRR	146	167	2.54e1	SMART
LRR	168	190	3.24e0	SMART
LRR	192	214	7.16e0	SMART
Blast:LRR	217	239	7e-6	BLAST
low complexity region	275	292	N/A	INTRINSIC
coiled coil region	437	540	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000028237
AA Change: I159F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000028237
Gene: ENSMUSG00000057110
AA Change: I159F

Domain	Start	End	E-Value	Type
low complexity region	21	38	N/A	INTRINSIC
LRR	146	167	2.54e1	SMART
LRR	168	190	3.24e0	SMART
LRR	192	214	7.16e0	SMART
Blast:LRR	217	239	8e-6	BLAST
low complexity region	275	292	N/A	INTRINSIC
coiled coil region	437	800	N/A	INTRINSIC
coiled coil region	858	971	N/A	INTRINSIC
low complexity region	975	995	N/A	INTRINSIC
coiled coil region	998	1102	N/A	INTRINSIC
internal_repeat_1	1119	1132	1.95e-5	PROSPERO
low complexity region	1153	1161	N/A	INTRINSIC
low complexity region	1268	1301	N/A	INTRINSIC
coiled coil region	1320	1629	N/A	INTRINSIC
coiled coil region	1661	2155	N/A	INTRINSIC
low complexity region	2193	2208	N/A	INTRINSIC
internal_repeat_1	2252	2265	1.95e-5	PROSPERO
low complexity region	2289	2307	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000113032
AA Change: I159F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000108655
Gene: ENSMUSG00000057110
AA Change: I159F

Domain	Start	End	E-Value	Type
low complexity region	20	53	N/A	INTRINSIC
coiled coil region	72	381	N/A	INTRINSIC
coiled coil region	413	907	N/A	INTRINSIC
low complexity region	945	960	N/A	INTRINSIC
coiled coil region	989	1011	N/A	INTRINSIC
low complexity region	1041	1059	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000156933
AA Change: I159F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000118731
Gene: ENSMUSG00000057110
AA Change: I159F

Domain	Start	End	E-Value	Type
low complexity region	21	38	N/A	INTRINSIC
LRR	146	167	2.54e1	SMART
LRR	168	190	3.24e0	SMART
LRR	192	214	7.16e0	SMART
Blast:LRR	217	239	7e-6	BLAST
low complexity region	275	292	N/A	INTRINSIC
coiled coil region	437	800	N/A	INTRINSIC
coiled coil region	858	971	N/A	INTRINSIC
low complexity region	975	995	N/A	INTRINSIC
coiled coil region	998	1102	N/A	INTRINSIC
internal_repeat_1	1119	1132	1.65e-5	PROSPERO
low complexity region	1153	1161	N/A	INTRINSIC
low complexity region	1268	1301	N/A	INTRINSIC
coiled coil region	1320	1629	N/A	INTRINSIC
coiled coil region	1661	2155	N/A	INTRINSIC
low complexity region	2193	2208	N/A	INTRINSIC
internal_repeat_1	2252	2265	1.65e-5	PROSPERO
low complexity region	2289	2307	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (89/89)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a centrosomal protein required for the centrosome to function as a microtubule organizing center. The gene product is also associated with centrosome maturation. One version of stem cell myeloproliferative disorder is the result of a reciprocal translocation between chromosomes 8 and 9, with the breakpoint associated with fibroblast growth factor receptor 1 and centrosomal protein 1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit cardiac defects, including double outlet right ventricle, atrial septal defects, ventricular septal defects, tricuspid valve stenosis and heart right ventricle hypoplasia, and develop kidney cysts and hydronephrosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 91 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010109A12Rik	G	A	5: 93,206,557		probably null	Het
2410004P03Rik	C	T	12: 17,007,148	S116N	probably damaging	Het
3425401B19Rik	T	C	14: 32,663,069	D313G	possibly damaging	Het
AA986860	A	G	1: 130,743,547	E502G	possibly damaging	Het
Adamts20	T	A	15: 94,291,587	K1462*	probably null	Het
Adgrg6	A	C	10: 14,450,577		probably null	Het
Ankrd13d	G	A	19: 4,280,985	H165Y	probably damaging	Het
Arap3	T	C	18: 37,988,888		probably null	Het
Arhgap33	A	G	7: 30,524,135	V823A	probably damaging	Het
Aup1	C	A	6: 83,054,795	P34T	unknown	Het
Bcl2l2	C	T	14: 54,884,379		probably benign	Het
Bicc1	T	C	10: 70,946,993	T515A	probably benign	Het
Ccdc73	A	C	2: 104,929,556	K106Q	probably damaging	Het
Celsr3	G	A	9: 108,829,978	R1220Q	possibly damaging	Het
Cep290	C	T	10: 100,558,176	Q2082*	probably null	Het
Cercam	A	G	2: 29,871,286	D104G	probably benign	Het
Champ1	A	G	8: 13,879,990	H716R	probably damaging	Het
Col11a1	T	C	3: 114,102,572	I507T	unknown	Het
Cped1	T	C	6: 22,143,974	I573T	probably damaging	Het
Crot	C	T	5: 8,968,869		probably null	Het
D1Pas1	T	A	1: 186,968,677	S268T	probably benign	Het
Erich6	A	G	3: 58,618,928	V551A	probably damaging	Het
Fbxo32	T	C	15: 58,191,361	N192S	probably damaging	Het
Fgd6	T	C	10: 94,044,916	V544A	probably damaging	Het
Fnbp1	C	T	2: 31,036,147	G552E	probably damaging	Het
Gjb5	A	T	4: 127,356,162	V63D	probably damaging	Het
Gm10053	T	C	19: 24,876,039	I96T	probably benign	Het
Gm11639	T	G	11: 104,842,603	I2011S	probably damaging	Het
Gm38119	T	C	3: 92,738,021	S89G	unknown	Het
Gm884	A	T	11: 103,614,255	S2296T	probably damaging	Het
Gpn2	A	G	4: 133,586,045	I183V	probably benign	Het
Greb1	C	T	12: 16,674,795	V1793M	probably benign	Het
H2-Q7	A	G	17: 35,440,061	I163V	probably benign	Het
Hrh2	T	C	13: 54,214,530	V175A	possibly damaging	Het
Hsd3b3	C	T	3: 98,743,898	V79I	possibly damaging	Het
Itgb7	T	C	15: 102,216,604	I727M	possibly damaging	Het
Kcnj16	T	A	11: 111,024,743	F77Y	probably damaging	Het
Lilra6	T	A	7: 3,912,996	Q288L	probably benign	Het
Malrd1	G	A	2: 16,074,835	V1788M	unknown	Het
Mau2	T	C	8: 70,026,723	I349V	possibly damaging	Het
Mbnl3	C	T	X: 51,130,334	R181H	probably damaging	Het
Mfsd6	T	C	1: 52,676,547	T524A	probably benign	Het
Mical2	G	T	7: 112,333,839	R740L	probably benign	Het
Mknk1	G	A	4: 115,878,072	C379Y	possibly damaging	Het
Mta3	A	T	17: 83,791,736	K410*	probably null	Het
Myb	A	C	10: 21,156,425	I19S	possibly damaging	Het
Ncor2	A	G	5: 125,027,038	F996S		Het
Nlrp1a	T	C	11: 71,123,408	M339V	possibly damaging	Het
Olfr136	C	T	17: 38,335,394	P79L	probably benign	Het
Olfr689	A	G	7: 105,314,447	K148E	probably damaging	Het
Pcdhga5	C	T	18: 37,696,782	T761I	possibly damaging	Het
Pcmtd2	T	C	2: 181,851,659	L219P	possibly damaging	Het
Pfdn1	C	T	18: 36,432,305		probably null	Het
Pkn3	G	A	2: 30,090,584	C829Y	probably benign	Het
Pld1	T	C	3: 28,087,189	S634P	possibly damaging	Het
Pofut2	T	G	10: 77,262,470	V139G	possibly damaging	Het
Prdm12	C	A	2: 31,653,871		probably null	Het
Prkar2b	C	A	12: 32,060,938	A49S	probably benign	Het
Prmt1	A	T	7: 44,984,136		probably null	Het
Rab39	A	T	9: 53,686,400	D188E	probably benign	Het
Repin1	G	T	6: 48,597,345	E403*	probably null	Het
Scgb1b19	A	G	7: 33,287,498	I25V	probably benign	Het
Scn9a	A	T	2: 66,484,298	I1692N	probably damaging	Het
Sdk1	G	T	5: 142,084,491	G1137V	probably damaging	Het
Sec16b	A	G	1: 157,565,472	T950A	possibly damaging	Het
Senp2	G	T	16: 22,038,622	R398L	probably damaging	Het
Sfswap	G	T	5: 129,550,593		probably null	Het
Sh3rf1	A	G	8: 61,353,753	T362A	probably damaging	Het
Slc17a1	A	T	13: 23,888,052	I418F	probably benign	Het
Slc1a4	A	T	11: 20,308,587	M284K	probably damaging	Het
Slc5a2	A	T	7: 128,266,395		probably null	Het
Slco5a1	A	G	1: 12,990,122	V125A	probably benign	Het
Smu1	A	G	4: 40,748,600	V230A	probably benign	Het
Sp4	A	G	12: 118,254,404		probably null	Het
Stbd1	A	G	5: 92,605,557	K302R	probably damaging	Het
Stx2	A	T	5: 128,986,417	V268D	probably benign	Het
Tbc1d9b	G	A	11: 50,161,620	A885T	probably benign	Het
Tbce	T	A	13: 14,006,478	D267V	possibly damaging	Het
Tert	T	C	13: 73,627,606	Y159H	probably damaging	Het
Thbs2	T	A	17: 14,670,039	I1102F	possibly damaging	Het
Tmprss7	G	C	16: 45,683,510	A183G	probably benign	Het
Top3b	C	A	16: 16,887,721	P450Q	probably benign	Het
Trpm6	A	T	19: 18,750,045		probably null	Het
Ube4a	T	C	9: 44,925,973	D988G	probably damaging	Het
Vmn1r158	A	T	7: 22,790,300	S161R	probably benign	Het
Vps41	T	C	13: 18,841,252		probably null	Het
Zfp354c	TCACACTCGGCACA	TCACA	11: 50,815,240		probably benign	Het
Zfp617	T	A	8: 71,928,189		probably null	Het
Zfp808	C	T	13: 62,171,505	H183Y	probably benign	Het
Zfy1	A	T	Y: 725,496	C756*	probably null	Het
Zswim2	A	T	2: 83,915,607	Y496N	probably damaging	Het

Other mutations in Cntrl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00392:Cntrl	APN	2	35137814	splice site	probably benign
IGL00478:Cntrl	APN	2	35160601	missense	probably damaging	0.98
IGL01460:Cntrl	APN	2	35165844	missense	probably benign	0.04
IGL01556:Cntrl	APN	2	35173059	missense	probably benign	0.19
IGL02155:Cntrl	APN	2	35160238	splice site	probably benign
IGL02419:Cntrl	APN	2	35134043	missense	probably damaging	0.97
PIT4480001:Cntrl	UTSW	2	35155428	missense	probably damaging	0.96
R0179:Cntrl	UTSW	2	35167859	missense	probably benign	0.00
R0276:Cntrl	UTSW	2	35151732	missense	possibly damaging	0.62
R0471:Cntrl	UTSW	2	35127380	missense	probably benign	0.41
R0755:Cntrl	UTSW	2	35145139	missense	probably damaging	1.00
R0763:Cntrl	UTSW	2	35171066	missense	probably benign
R0781:Cntrl	UTSW	2	35160627	missense	possibly damaging	0.66
R0791:Cntrl	UTSW	2	35155279	missense	possibly damaging	0.83
R0792:Cntrl	UTSW	2	35155279	missense	possibly damaging	0.83
R0801:Cntrl	UTSW	2	35175095	splice site	probably benign
R1067:Cntrl	UTSW	2	35149022	unclassified	probably benign
R1110:Cntrl	UTSW	2	35160627	missense	possibly damaging	0.66
R1117:Cntrl	UTSW	2	35127973	missense	probably damaging	1.00
R1457:Cntrl	UTSW	2	35122756	missense	probably benign	0.00
R1472:Cntrl	UTSW	2	35169317	critical splice donor site	probably null
R1522:Cntrl	UTSW	2	35155279	missense	possibly damaging	0.83
R1702:Cntrl	UTSW	2	35171836	critical splice acceptor site	probably null
R1762:Cntrl	UTSW	2	35122806	frame shift	probably null
R1785:Cntrl	UTSW	2	35122806	frame shift	probably null
R1786:Cntrl	UTSW	2	35122806	frame shift	probably null
R1812:Cntrl	UTSW	2	35149469	missense	probably damaging	0.97
R1854:Cntrl	UTSW	2	35122684	missense	probably damaging	1.00
R1863:Cntrl	UTSW	2	35118119	missense	possibly damaging	0.93
R1868:Cntrl	UTSW	2	35129815	missense	probably benign	0.03
R1914:Cntrl	UTSW	2	35162861	missense	probably benign	0.00
R1915:Cntrl	UTSW	2	35162861	missense	probably benign	0.00
R2049:Cntrl	UTSW	2	35122806	frame shift	probably null
R2118:Cntrl	UTSW	2	35161965	missense	probably benign	0.31
R2140:Cntrl	UTSW	2	35122806	frame shift	probably null
R2142:Cntrl	UTSW	2	35122806	frame shift	probably null
R2203:Cntrl	UTSW	2	35143737	missense	possibly damaging	0.84
R2300:Cntrl	UTSW	2	35127513	missense	probably benign	0.00
R2349:Cntrl	UTSW	2	35176251	missense	probably benign	0.18
R2374:Cntrl	UTSW	2	35153276	missense	possibly damaging	0.46
R3429:Cntrl	UTSW	2	35145100	missense	probably damaging	1.00
R3890:Cntrl	UTSW	2	35170480	missense	probably benign	0.02
R3911:Cntrl	UTSW	2	35120049	missense	probably damaging	1.00
R3922:Cntrl	UTSW	2	35129739	missense	probably damaging	0.98
R4081:Cntrl	UTSW	2	35161926	splice site	probably benign
R4081:Cntrl	UTSW	2	35175125	missense	probably damaging	1.00
R4516:Cntrl	UTSW	2	35127981	missense	probably benign	0.00
R4518:Cntrl	UTSW	2	35148974	missense	probably damaging	1.00
R4519:Cntrl	UTSW	2	35173111	missense	probably damaging	1.00
R4646:Cntrl	UTSW	2	35149461	missense	probably damaging	0.99
R4753:Cntrl	UTSW	2	35153439	missense	possibly damaging	0.90
R4763:Cntrl	UTSW	2	35175551	missense	probably damaging	1.00
R4916:Cntrl	UTSW	2	35165682	missense	probably benign	0.42
R5168:Cntrl	UTSW	2	35157655	missense	probably damaging	1.00
R5291:Cntrl	UTSW	2	35134060	missense	probably damaging	1.00
R5356:Cntrl	UTSW	2	35148899	nonsense	probably null
R5774:Cntrl	UTSW	2	35162861	missense	probably benign	0.15
R5947:Cntrl	UTSW	2	35116679	missense	probably damaging	1.00
R6144:Cntrl	UTSW	2	35165733	missense	possibly damaging	0.93
R6147:Cntrl	UTSW	2	35165733	missense	possibly damaging	0.93
R6214:Cntrl	UTSW	2	35129634	missense	probably benign	0.10
R6267:Cntrl	UTSW	2	35129793	missense	probably damaging	1.00
R6332:Cntrl	UTSW	2	35128024	missense	possibly damaging	0.78
R6445:Cntrl	UTSW	2	35162848	missense	probably benign	0.05
R6487:Cntrl	UTSW	2	35122682	missense	possibly damaging	0.89
R6497:Cntrl	UTSW	2	35135572	missense	possibly damaging	0.66
R6782:Cntrl	UTSW	2	35170646	missense	possibly damaging	0.75
R6815:Cntrl	UTSW	2	35149491	missense	probably damaging	1.00
R6853:Cntrl	UTSW	2	35129821	missense	possibly damaging	0.87
R6858:Cntrl	UTSW	2	35162095	critical splice donor site	probably null
R6965:Cntrl	UTSW	2	35162833	missense	probably benign	0.20
R6970:Cntrl	UTSW	2	35118137	missense	probably benign
R7085:Cntrl	UTSW	2	35165792	missense	probably benign	0.00
R7150:Cntrl	UTSW	2	35165445	critical splice acceptor site	probably null
R7213:Cntrl	UTSW	2	35135680	missense	possibly damaging	0.95
R7221:Cntrl	UTSW	2	35151857	missense	possibly damaging	0.46
R7389:Cntrl	UTSW	2	35127517	missense	probably benign	0.01
R7414:Cntrl	UTSW	2	35165467	missense	probably benign	0.02
R7427:Cntrl	UTSW	2	35170534	missense	probably benign	0.00
R7428:Cntrl	UTSW	2	35170534	missense	probably benign	0.00
R7453:Cntrl	UTSW	2	35155409	missense	possibly damaging	0.89
R7753:Cntrl	UTSW	2	35111679	missense	probably damaging	1.00
R7811:Cntrl	UTSW	2	35162861	missense	probably benign	0.00
R7882:Cntrl	UTSW	2	35170580	missense	probably benign	0.41
R7919:Cntrl	UTSW	2	35127401	missense	probably benign
R8314:Cntrl	UTSW	2	35175143	missense	probably benign	0.00
R8332:Cntrl	UTSW	2	35126025	missense	probably damaging	1.00
R8681:Cntrl	UTSW	2	35148588	missense	probably damaging	1.00
R8698:Cntrl	UTSW	2	35133962	missense	probably damaging	0.98
R8717:Cntrl	UTSW	2	35113339	missense	probably benign	0.40
R8960:Cntrl	UTSW	2	35162041	missense	possibly damaging	0.89
R9036:Cntrl	UTSW	2	35126059	missense	probably damaging	1.00
R9617:Cntrl	UTSW	2	35145065	missense	probably benign	0.00
R9621:Cntrl	UTSW	2	35160266	missense	probably damaging	0.96
RF007:Cntrl	UTSW	2	35170500	missense	probably benign
RF016:Cntrl	UTSW	2	35119986	missense	probably benign
RF017:Cntrl	UTSW	2	35175189	missense	probably damaging	0.96
X0024:Cntrl	UTSW	2	35147296	missense	probably damaging	1.00
X0026:Cntrl	UTSW	2	35149516	missense	probably damaging	1.00
X0027:Cntrl	UTSW	2	35157768	missense	probably damaging	1.00
X0027:Cntrl	UTSW	2	35165682	missense	probably benign	0.08
X0028:Cntrl	UTSW	2	35147344	missense	possibly damaging	0.83

Predicted Primers

PCR Primer
(F):5'- CCTCTAAAAGTGTCAAGAAGCCTG -3'
(R):5'- CCATGAAAAGGTATCTGCTTTCG -3'

Sequencing Primer
(F):5'- AGTGTCAAGAAGCCTGTTATATAAAG -3'
(R):5'- GCTTTCGCAATGCTAAGTAAAAAC -3'

Posted On

2019-11-26