Incidental Mutation 'R7747:Scn9a'
ID 596880
Institutional Source Beutler Lab
Gene Symbol Scn9a
Ensembl Gene ENSMUSG00000075316
Gene Name sodium channel, voltage-gated, type IX, alpha
Synonyms PN1
MMRRC Submission 045803-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7747 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 66310424-66465306 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 66314642 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 1692 (I1692N)
Ref Sequence ENSEMBL: ENSMUSP00000097642 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100063] [ENSMUST00000100064] [ENSMUST00000112354] [ENSMUST00000164384] [ENSMUST00000169900]
AlphaFold Q62205
Predicted Effect probably damaging
Transcript: ENSMUST00000100063
AA Change: I1683N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097641
Gene: ENSMUSG00000075316
AA Change: I1683N

DomainStartEndE-ValueType
low complexity region 29 49 N/A INTRINSIC
Pfam:Ion_trans 154 403 9.5e-78 PFAM
coiled coil region 404 442 N/A INTRINSIC
Pfam:DUF3451 465 685 1.3e-62 PFAM
Pfam:Ion_trans 768 957 9.9e-48 PFAM
Pfam:Na_trans_assoc 972 1191 2.9e-72 PFAM
low complexity region 1203 1214 N/A INTRINSIC
Pfam:Ion_trans 1217 1445 2.8e-55 PFAM
PDB:1BYY|A 1447 1499 9e-27 PDB
Pfam:Ion_trans 1538 1748 3.4e-52 PFAM
Pfam:PKD_channel 1599 1755 1.1e-7 PFAM
IQ 1877 1899 1.03e-3 SMART
low complexity region 1956 1972 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000100064
AA Change: I1692N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097642
Gene: ENSMUSG00000075316
AA Change: I1692N

DomainStartEndE-ValueType
low complexity region 29 49 N/A INTRINSIC
Pfam:Ion_trans 125 412 2.2e-84 PFAM
low complexity region 433 446 N/A INTRINSIC
Pfam:Na_trans_cytopl 483 693 7.5e-76 PFAM
Pfam:Ion_trans 742 977 4.1e-57 PFAM
Pfam:Na_trans_assoc 981 1185 1.4e-58 PFAM
Pfam:Ion_trans 1189 1466 7e-67 PFAM
Pfam:Ion_trans 1512 1769 1e-55 PFAM
Pfam:PKD_channel 1605 1763 2.6e-7 PFAM
IQ 1886 1908 1.03e-3 SMART
low complexity region 1965 1981 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112354
AA Change: I1681N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107973
Gene: ENSMUSG00000075316
AA Change: I1681N

DomainStartEndE-ValueType
low complexity region 29 49 N/A INTRINSIC
Pfam:Ion_trans 154 401 1.2e-77 PFAM
coiled coil region 402 449 N/A INTRINSIC
Pfam:DUF3451 463 683 1.3e-62 PFAM
Pfam:Ion_trans 766 955 9.9e-48 PFAM
Pfam:Na_trans_assoc 970 1189 2.9e-72 PFAM
low complexity region 1201 1212 N/A INTRINSIC
Pfam:Ion_trans 1215 1443 2.8e-55 PFAM
PDB:1BYY|A 1445 1497 7e-29 PDB
Pfam:Ion_trans 1536 1746 3.4e-52 PFAM
Pfam:PKD_channel 1597 1753 1.1e-7 PFAM
IQ 1875 1897 1.03e-3 SMART
low complexity region 1954 1970 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000164384
AA Change: I1692N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126528
Gene: ENSMUSG00000075316
AA Change: I1692N

DomainStartEndE-ValueType
low complexity region 29 49 N/A INTRINSIC
Pfam:Ion_trans 154 401 1.1e-77 PFAM
coiled coil region 402 449 N/A INTRINSIC
Pfam:DUF3451 463 694 4.2e-66 PFAM
Pfam:Ion_trans 777 966 8.8e-48 PFAM
Pfam:Na_trans_assoc 981 1200 6e-72 PFAM
low complexity region 1212 1223 N/A INTRINSIC
Pfam:Ion_trans 1226 1454 2.5e-55 PFAM
PDB:1BYY|A 1456 1508 6e-29 PDB
Pfam:Ion_trans 1547 1757 3e-52 PFAM
Pfam:PKD_channel 1608 1764 8.1e-8 PFAM
IQ 1886 1908 1.03e-3 SMART
low complexity region 1965 1981 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169900
AA Change: I1681N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131711
Gene: ENSMUSG00000075316
AA Change: I1681N

DomainStartEndE-ValueType
low complexity region 29 49 N/A INTRINSIC
Pfam:Ion_trans 154 401 3.7e-78 PFAM
coiled coil region 402 449 N/A INTRINSIC
Pfam:DUF3451 463 683 1.3e-62 PFAM
Pfam:Ion_trans 766 955 9.9e-48 PFAM
Pfam:Na_trans_assoc 970 1189 2.9e-72 PFAM
low complexity region 1201 1212 N/A INTRINSIC
Pfam:Ion_trans 1215 1443 2.8e-55 PFAM
PDB:1BYY|A 1445 1497 7e-29 PDB
Pfam:Ion_trans 1536 1746 3.4e-52 PFAM
Pfam:PKD_channel 1597 1753 1.1e-7 PFAM
IQ 1875 1897 1.03e-3 SMART
low complexity region 1954 1970 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (89/89)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a voltage-gated sodium channel which plays a significant role in nociception signaling. Mutations in this gene have been associated with primary erythermalgia, channelopathy-associated insensitivity to pain, and paroxysmal extreme pain disorder. [provided by RefSeq, Aug 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit prenatal/neonatal lethality. Mice homozygous for a knock-in allele exhibit increased susceptibility to electrically induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010109A12Rik G A 5: 93,354,416 (GRCm39) probably null Het
2410004P03Rik C T 12: 17,057,149 (GRCm39) S116N probably damaging Het
3425401B19Rik T C 14: 32,385,026 (GRCm39) D313G possibly damaging Het
AA986860 A G 1: 130,671,284 (GRCm39) E502G possibly damaging Het
Adamts20 T A 15: 94,189,468 (GRCm39) K1462* probably null Het
Adgrg6 A C 10: 14,326,321 (GRCm39) probably null Het
Ankrd13d G A 19: 4,331,013 (GRCm39) H165Y probably damaging Het
Arap3 T C 18: 38,121,941 (GRCm39) probably null Het
Arhgap33 A G 7: 30,223,560 (GRCm39) V823A probably damaging Het
Aup1 C A 6: 83,031,776 (GRCm39) P34T unknown Het
Bcl2l2 C T 14: 55,121,836 (GRCm39) probably benign Het
Bicc1 T C 10: 70,782,823 (GRCm39) T515A probably benign Het
Ccdc73 A C 2: 104,759,901 (GRCm39) K106Q probably damaging Het
Celsr3 G A 9: 108,707,177 (GRCm39) R1220Q possibly damaging Het
Cep290 C T 10: 100,394,038 (GRCm39) Q2082* probably null Het
Cercam A G 2: 29,761,298 (GRCm39) D104G probably benign Het
Champ1 A G 8: 13,929,990 (GRCm39) H716R probably damaging Het
Cntrl A T 2: 35,006,810 (GRCm39) I159F probably damaging Het
Col11a1 T C 3: 113,896,221 (GRCm39) I507T unknown Het
Cped1 T C 6: 22,143,973 (GRCm39) I573T probably damaging Het
Crot C T 5: 9,018,869 (GRCm39) probably null Het
D1Pas1 T A 1: 186,700,874 (GRCm39) S268T probably benign Het
Efcab3 T G 11: 104,733,429 (GRCm39) I2011S probably damaging Het
Erich6 A G 3: 58,526,349 (GRCm39) V551A probably damaging Het
Fbxo32 T C 15: 58,054,757 (GRCm39) N192S probably damaging Het
Fgd6 T C 10: 93,880,778 (GRCm39) V544A probably damaging Het
Fnbp1 C T 2: 30,926,159 (GRCm39) G552E probably damaging Het
Gjb5 A T 4: 127,249,955 (GRCm39) V63D probably damaging Het
Gm10053 T C 19: 24,853,403 (GRCm39) I96T probably benign Het
Gm38119 T C 3: 92,645,328 (GRCm39) S89G unknown Het
Gpn2 A G 4: 133,313,356 (GRCm39) I183V probably benign Het
Greb1 C T 12: 16,724,796 (GRCm39) V1793M probably benign Het
H2-Q7 A G 17: 35,659,037 (GRCm39) I163V probably benign Het
Hrh2 T C 13: 54,368,549 (GRCm39) V175A possibly damaging Het
Hsd3b3 C T 3: 98,651,214 (GRCm39) V79I possibly damaging Het
Itgb7 T C 15: 102,125,039 (GRCm39) I727M possibly damaging Het
Kcnj16 T A 11: 110,915,569 (GRCm39) F77Y probably damaging Het
Lilra6 T A 7: 3,915,995 (GRCm39) Q288L probably benign Het
Lrrc37 A T 11: 103,505,081 (GRCm39) S2296T probably damaging Het
Malrd1 G A 2: 16,079,646 (GRCm39) V1788M unknown Het
Mau2 T C 8: 70,479,373 (GRCm39) I349V possibly damaging Het
Mbnl3 C T X: 50,219,211 (GRCm39) R181H probably damaging Het
Mfsd6 T C 1: 52,715,706 (GRCm39) T524A probably benign Het
Mical2 G T 7: 111,933,046 (GRCm39) R740L probably benign Het
Mknk1 G A 4: 115,735,269 (GRCm39) C379Y possibly damaging Het
Mta3 A T 17: 84,099,165 (GRCm39) K410* probably null Het
Myb A C 10: 21,032,324 (GRCm39) I19S possibly damaging Het
Ncor2 A G 5: 125,104,102 (GRCm39) F996S Het
Nlrp1a T C 11: 71,014,234 (GRCm39) M339V possibly damaging Het
Or2n1d C T 17: 38,646,285 (GRCm39) P79L probably benign Het
Or56b35 A G 7: 104,963,654 (GRCm39) K148E probably damaging Het
Pcdhga5 C T 18: 37,829,835 (GRCm39) T761I possibly damaging Het
Pcmtd2 T C 2: 181,493,452 (GRCm39) L219P possibly damaging Het
Pfdn1 C T 18: 36,565,358 (GRCm39) probably null Het
Pkn3 G A 2: 29,980,596 (GRCm39) C829Y probably benign Het
Pld1 T C 3: 28,141,338 (GRCm39) S634P possibly damaging Het
Pofut2 T G 10: 77,098,304 (GRCm39) V139G possibly damaging Het
Prdm12 C A 2: 31,543,883 (GRCm39) probably null Het
Prkar2b C A 12: 32,110,937 (GRCm39) A49S probably benign Het
Prmt1 A T 7: 44,633,560 (GRCm39) probably null Het
Rab39 A T 9: 53,597,700 (GRCm39) D188E probably benign Het
Repin1 G T 6: 48,574,279 (GRCm39) E403* probably null Het
Scgb1b19 A G 7: 32,986,923 (GRCm39) I25V probably benign Het
Sdk1 G T 5: 142,070,246 (GRCm39) G1137V probably damaging Het
Sec16b A G 1: 157,393,042 (GRCm39) T950A possibly damaging Het
Senp2 G T 16: 21,857,372 (GRCm39) R398L probably damaging Het
Sfswap G T 5: 129,627,657 (GRCm39) probably null Het
Sh3rf1 A G 8: 61,806,787 (GRCm39) T362A probably damaging Het
Slc17a1 A T 13: 24,072,035 (GRCm39) I418F probably benign Het
Slc1a4 A T 11: 20,258,587 (GRCm39) M284K probably damaging Het
Slc5a2 A T 7: 127,865,567 (GRCm39) probably null Het
Slco5a1 A G 1: 13,060,346 (GRCm39) V125A probably benign Het
Smu1 A G 4: 40,748,600 (GRCm39) V230A probably benign Het
Sp4 A G 12: 118,218,139 (GRCm39) probably null Het
Stbd1 A G 5: 92,753,416 (GRCm39) K302R probably damaging Het
Stx2 A T 5: 129,063,481 (GRCm39) V268D probably benign Het
Tbc1d9b G A 11: 50,052,447 (GRCm39) A885T probably benign Het
Tbce T A 13: 14,181,063 (GRCm39) D267V possibly damaging Het
Tert T C 13: 73,775,725 (GRCm39) Y159H probably damaging Het
Thbs2 T A 17: 14,890,301 (GRCm39) I1102F possibly damaging Het
Tmprss7 G C 16: 45,503,873 (GRCm39) A183G probably benign Het
Top3b C A 16: 16,705,585 (GRCm39) P450Q probably benign Het
Trpm6 A T 19: 18,727,409 (GRCm39) probably null Het
Ube4a T C 9: 44,837,271 (GRCm39) D988G probably damaging Het
Vmn1r158 A T 7: 22,489,725 (GRCm39) S161R probably benign Het
Vps41 T C 13: 19,025,422 (GRCm39) probably null Het
Zfp354c TCACACTCGGCACA TCACA 11: 50,706,067 (GRCm39) probably benign Het
Zfp617 T A 8: 72,682,033 (GRCm39) probably null Het
Zfp808 C T 13: 62,319,319 (GRCm39) H183Y probably benign Het
Zfy1 A T Y: 725,496 (GRCm39) C756* probably null Het
Zswim2 A T 2: 83,745,951 (GRCm39) Y496N probably damaging Het
Other mutations in Scn9a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00514:Scn9a APN 2 66,393,945 (GRCm39) missense probably damaging 1.00
IGL00570:Scn9a APN 2 66,314,486 (GRCm39) missense probably damaging 1.00
IGL00809:Scn9a APN 2 66,314,279 (GRCm39) missense probably damaging 1.00
IGL00977:Scn9a APN 2 66,314,645 (GRCm39) missense probably damaging 0.99
IGL01120:Scn9a APN 2 66,357,316 (GRCm39) missense probably benign 0.00
IGL01134:Scn9a APN 2 66,335,312 (GRCm39) missense probably damaging 1.00
IGL01300:Scn9a APN 2 66,318,397 (GRCm39) nonsense probably null
IGL01452:Scn9a APN 2 66,357,416 (GRCm39) missense probably damaging 1.00
IGL01531:Scn9a APN 2 66,367,722 (GRCm39) missense probably benign 0.11
IGL01572:Scn9a APN 2 66,324,230 (GRCm39) missense probably benign 0.00
IGL01645:Scn9a APN 2 66,317,986 (GRCm39) missense possibly damaging 0.62
IGL01823:Scn9a APN 2 66,314,386 (GRCm39) missense probably damaging 1.00
IGL01965:Scn9a APN 2 66,314,777 (GRCm39) missense probably damaging 1.00
IGL02127:Scn9a APN 2 66,325,170 (GRCm39) missense probably damaging 1.00
IGL02127:Scn9a APN 2 66,377,479 (GRCm39) missense probably damaging 1.00
IGL02166:Scn9a APN 2 66,323,447 (GRCm39) missense possibly damaging 0.95
IGL02183:Scn9a APN 2 66,314,955 (GRCm39) splice site probably benign
IGL02640:Scn9a APN 2 66,366,440 (GRCm39) critical splice donor site probably null
IGL02685:Scn9a APN 2 66,367,637 (GRCm39) missense probably damaging 1.00
IGL02798:Scn9a APN 2 66,370,903 (GRCm39) missense possibly damaging 0.52
IGL02832:Scn9a APN 2 66,398,373 (GRCm39) missense probably damaging 1.00
IGL03008:Scn9a APN 2 66,392,855 (GRCm39) missense probably damaging 1.00
IGL03270:Scn9a APN 2 66,314,358 (GRCm39) missense probably damaging 1.00
IGL03408:Scn9a APN 2 66,357,091 (GRCm39) missense probably benign 0.00
BB007:Scn9a UTSW 2 66,335,193 (GRCm39) missense probably damaging 0.99
BB017:Scn9a UTSW 2 66,335,193 (GRCm39) missense probably damaging 0.99
R0039:Scn9a UTSW 2 66,392,788 (GRCm39) missense probably damaging 0.98
R0173:Scn9a UTSW 2 66,363,437 (GRCm39) missense probably damaging 1.00
R0323:Scn9a UTSW 2 66,398,475 (GRCm39) missense probably damaging 1.00
R0344:Scn9a UTSW 2 66,335,354 (GRCm39) missense probably damaging 0.99
R0421:Scn9a UTSW 2 66,373,621 (GRCm39) missense probably benign
R0465:Scn9a UTSW 2 66,357,340 (GRCm39) missense probably damaging 1.00
R0514:Scn9a UTSW 2 66,314,022 (GRCm39) missense probably damaging 1.00
R0599:Scn9a UTSW 2 66,357,143 (GRCm39) missense probably damaging 0.96
R0627:Scn9a UTSW 2 66,367,721 (GRCm39) missense probably benign 0.00
R0644:Scn9a UTSW 2 66,363,405 (GRCm39) critical splice donor site probably null
R0653:Scn9a UTSW 2 66,363,721 (GRCm39) missense probably damaging 1.00
R0685:Scn9a UTSW 2 66,313,843 (GRCm39) missense probably benign 0.02
R0718:Scn9a UTSW 2 66,377,456 (GRCm39) missense probably damaging 1.00
R0827:Scn9a UTSW 2 66,366,468 (GRCm39) nonsense probably null
R0890:Scn9a UTSW 2 66,314,079 (GRCm39) missense probably damaging 1.00
R1139:Scn9a UTSW 2 66,335,341 (GRCm39) missense probably benign 0.02
R1385:Scn9a UTSW 2 66,393,886 (GRCm39) missense probably damaging 1.00
R1398:Scn9a UTSW 2 66,314,930 (GRCm39) missense probably benign 0.11
R1496:Scn9a UTSW 2 66,357,232 (GRCm39) missense probably benign
R1511:Scn9a UTSW 2 66,357,157 (GRCm39) missense probably benign 0.01
R1517:Scn9a UTSW 2 66,335,371 (GRCm39) splice site probably benign
R1564:Scn9a UTSW 2 66,314,648 (GRCm39) missense probably damaging 1.00
R1634:Scn9a UTSW 2 66,318,361 (GRCm39) missense probably damaging 1.00
R1662:Scn9a UTSW 2 66,313,803 (GRCm39) missense probably benign 0.00
R1695:Scn9a UTSW 2 66,335,220 (GRCm39) nonsense probably null
R1709:Scn9a UTSW 2 66,313,850 (GRCm39) missense probably damaging 1.00
R1741:Scn9a UTSW 2 66,317,938 (GRCm39) missense probably damaging 0.99
R1755:Scn9a UTSW 2 66,332,060 (GRCm39) missense probably benign 0.38
R1914:Scn9a UTSW 2 66,396,594 (GRCm39) missense probably damaging 1.00
R1962:Scn9a UTSW 2 66,314,655 (GRCm39) missense probably damaging 1.00
R1970:Scn9a UTSW 2 66,345,724 (GRCm39) missense probably damaging 0.97
R2017:Scn9a UTSW 2 66,345,665 (GRCm39) missense probably damaging 0.99
R2092:Scn9a UTSW 2 66,363,720 (GRCm39) missense probably damaging 0.99
R2105:Scn9a UTSW 2 66,398,527 (GRCm39) missense probably benign 0.25
R2114:Scn9a UTSW 2 66,314,396 (GRCm39) missense probably damaging 1.00
R2115:Scn9a UTSW 2 66,314,396 (GRCm39) missense probably damaging 1.00
R2128:Scn9a UTSW 2 66,356,998 (GRCm39) missense probably damaging 1.00
R2157:Scn9a UTSW 2 66,366,669 (GRCm39) missense probably damaging 1.00
R2162:Scn9a UTSW 2 66,364,573 (GRCm39) missense probably damaging 0.98
R2350:Scn9a UTSW 2 66,335,312 (GRCm39) missense probably damaging 1.00
R3694:Scn9a UTSW 2 66,392,749 (GRCm39) missense probably benign
R3771:Scn9a UTSW 2 66,313,992 (GRCm39) missense probably benign 0.26
R3772:Scn9a UTSW 2 66,313,992 (GRCm39) missense probably benign 0.26
R3773:Scn9a UTSW 2 66,313,992 (GRCm39) missense probably benign 0.26
R3922:Scn9a UTSW 2 66,357,217 (GRCm39) missense possibly damaging 0.88
R3926:Scn9a UTSW 2 66,357,217 (GRCm39) missense possibly damaging 0.88
R4258:Scn9a UTSW 2 66,395,398 (GRCm39) intron probably benign
R4385:Scn9a UTSW 2 66,314,900 (GRCm39) missense probably damaging 1.00
R4415:Scn9a UTSW 2 66,357,037 (GRCm39) missense probably damaging 1.00
R4570:Scn9a UTSW 2 66,313,902 (GRCm39) missense possibly damaging 0.85
R4682:Scn9a UTSW 2 66,377,362 (GRCm39) missense probably benign
R4783:Scn9a UTSW 2 66,370,967 (GRCm39) missense probably benign 0.01
R4822:Scn9a UTSW 2 66,314,093 (GRCm39) missense possibly damaging 0.55
R4829:Scn9a UTSW 2 66,382,057 (GRCm39) missense probably benign
R4908:Scn9a UTSW 2 66,357,087 (GRCm39) missense probably benign 0.03
R4983:Scn9a UTSW 2 66,396,614 (GRCm39) missense probably benign 0.02
R5047:Scn9a UTSW 2 66,392,824 (GRCm39) missense probably damaging 1.00
R5100:Scn9a UTSW 2 66,364,463 (GRCm39) missense probably damaging 1.00
R5140:Scn9a UTSW 2 66,395,511 (GRCm39) missense possibly damaging 0.81
R5398:Scn9a UTSW 2 66,318,387 (GRCm39) missense probably damaging 1.00
R5557:Scn9a UTSW 2 66,377,447 (GRCm39) missense probably damaging 0.99
R5582:Scn9a UTSW 2 66,395,373 (GRCm39) intron probably benign
R6108:Scn9a UTSW 2 66,314,393 (GRCm39) missense probably damaging 1.00
R6115:Scn9a UTSW 2 66,393,973 (GRCm39) missense possibly damaging 0.70
R6143:Scn9a UTSW 2 66,317,868 (GRCm39) missense probably benign 0.00
R6261:Scn9a UTSW 2 66,314,240 (GRCm39) missense probably damaging 1.00
R6335:Scn9a UTSW 2 66,398,608 (GRCm39) start codon destroyed possibly damaging 0.91
R6429:Scn9a UTSW 2 66,357,307 (GRCm39) missense possibly damaging 0.95
R6632:Scn9a UTSW 2 66,313,846 (GRCm39) missense probably benign 0.23
R6681:Scn9a UTSW 2 66,393,686 (GRCm39) missense possibly damaging 0.90
R6830:Scn9a UTSW 2 66,398,373 (GRCm39) missense probably damaging 1.00
R7102:Scn9a UTSW 2 66,379,359 (GRCm39) missense probably damaging 1.00
R7186:Scn9a UTSW 2 66,364,567 (GRCm39) missense probably damaging 1.00
R7243:Scn9a UTSW 2 66,370,874 (GRCm39) missense probably damaging 1.00
R7311:Scn9a UTSW 2 66,314,748 (GRCm39) missense possibly damaging 0.54
R7328:Scn9a UTSW 2 66,314,931 (GRCm39) missense probably benign
R7386:Scn9a UTSW 2 66,370,894 (GRCm39) missense probably damaging 1.00
R7438:Scn9a UTSW 2 66,377,531 (GRCm39) missense possibly damaging 0.81
R7483:Scn9a UTSW 2 66,363,692 (GRCm39) missense probably damaging 0.99
R7485:Scn9a UTSW 2 66,364,561 (GRCm39) missense probably damaging 1.00
R7526:Scn9a UTSW 2 66,313,990 (GRCm39) missense probably benign
R7617:Scn9a UTSW 2 66,370,893 (GRCm39) missense possibly damaging 0.55
R7642:Scn9a UTSW 2 66,366,580 (GRCm39) missense probably benign 0.02
R7653:Scn9a UTSW 2 66,357,424 (GRCm39) missense probably damaging 1.00
R7823:Scn9a UTSW 2 66,314,135 (GRCm39) missense probably damaging 1.00
R7864:Scn9a UTSW 2 66,314,904 (GRCm39) missense possibly damaging 0.73
R7890:Scn9a UTSW 2 66,373,456 (GRCm39) missense probably benign 0.00
R7930:Scn9a UTSW 2 66,335,193 (GRCm39) missense probably damaging 0.99
R7975:Scn9a UTSW 2 66,314,597 (GRCm39) missense probably damaging 1.00
R8057:Scn9a UTSW 2 66,345,774 (GRCm39) missense probably benign 0.06
R8145:Scn9a UTSW 2 66,317,754 (GRCm39) missense probably damaging 1.00
R8163:Scn9a UTSW 2 66,314,745 (GRCm39) missense probably damaging 1.00
R8165:Scn9a UTSW 2 66,370,874 (GRCm39) missense probably damaging 1.00
R8342:Scn9a UTSW 2 66,366,626 (GRCm39) missense probably benign
R8345:Scn9a UTSW 2 66,324,966 (GRCm39) missense probably damaging 0.96
R8464:Scn9a UTSW 2 66,396,625 (GRCm39) missense probably damaging 0.99
R8467:Scn9a UTSW 2 66,332,015 (GRCm39) missense probably damaging 1.00
R8698:Scn9a UTSW 2 66,366,628 (GRCm39) missense probably benign 0.00
R8810:Scn9a UTSW 2 66,332,010 (GRCm39) missense probably damaging 1.00
R8822:Scn9a UTSW 2 66,370,979 (GRCm39) missense probably damaging 0.99
R8829:Scn9a UTSW 2 66,313,961 (GRCm39) missense probably benign
R9009:Scn9a UTSW 2 66,338,927 (GRCm39) missense probably damaging 1.00
R9038:Scn9a UTSW 2 66,325,147 (GRCm39) missense probably damaging 1.00
R9126:Scn9a UTSW 2 66,314,744 (GRCm39) missense probably damaging 1.00
R9205:Scn9a UTSW 2 66,363,657 (GRCm39) missense probably damaging 1.00
R9300:Scn9a UTSW 2 66,335,236 (GRCm39) missense probably benign 0.39
R9373:Scn9a UTSW 2 66,314,261 (GRCm39) missense probably benign 0.00
R9404:Scn9a UTSW 2 66,357,040 (GRCm39) missense probably benign 0.02
R9443:Scn9a UTSW 2 66,395,553 (GRCm39) missense probably damaging 1.00
R9590:Scn9a UTSW 2 66,314,328 (GRCm39) missense probably benign 0.05
R9612:Scn9a UTSW 2 66,363,708 (GRCm39) missense probably damaging 1.00
R9617:Scn9a UTSW 2 66,392,809 (GRCm39) missense probably damaging 1.00
R9717:Scn9a UTSW 2 66,357,002 (GRCm39) missense probably benign
X0003:Scn9a UTSW 2 66,338,991 (GRCm39) missense probably benign 0.02
X0062:Scn9a UTSW 2 66,398,421 (GRCm39) missense probably damaging 1.00
Z1176:Scn9a UTSW 2 66,370,936 (GRCm39) missense probably benign 0.00
Z1177:Scn9a UTSW 2 66,325,029 (GRCm39) missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- GTTCACCACAACCAGGAAGG -3'
(R):5'- TGGACGAATCCTACGCCTGATC -3'

Sequencing Primer
(F):5'- GTTCACCACAACCAGGAAGGATATG -3'
(R):5'- GAATCCTACGCCTGATCAAAGG -3'
Posted On 2019-11-26