Mutagenetix > Incidental Mutations

Incidental Mutation 'R0632:Msh4'

59689

Institutional Source

Beutler Lab

Gene Symbol

Msh4

Ensembl Gene

ENSMUSG00000005493

Gene Name

mutS homolog 4

Synonyms

mMsh4, 4930485C04Rik

MMRRC Submission

038821-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.438) question?

Stock #

R0632 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

153857149-153906138 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 153896895 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 232 (I232T)

Ref Sequence

ENSEMBL: ENSMUSP00000005630 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000005630] [ENSMUST00000188338] [ENSMUST00000190449]

Predicted Effect

probably damaging
Transcript: ENSMUST00000005630
AA Change: I232T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000005630
Gene: ENSMUSG00000005493
AA Change: I232T

Domain	Start	End	E-Value	Type
low complexity region	91	107	N/A	INTRINSIC
Pfam:MutS_II	177	321	2.3e-20	PFAM
MUTSd	352	679	3.77e-37	SMART
MUTSac	695	888	1.6e-81	SMART
Blast:MUTSac	912	956	1e-9	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000188338
AA Change: I144T

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000140190
Gene: ENSMUSG00000005493
AA Change: I144T

Domain	Start	End	E-Value	Type
Pfam:MutS_II	89	233	5.3e-19	PFAM
MUTSd	264	591	9.4e-40	SMART
MUTSac	607	800	4.2e-84	SMART
Blast:MUTSac	808	866	4e-17	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000190449
AA Change: I38T

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000140265
Gene: ENSMUSG00000005493
AA Change: I38T

Domain	Start	End	E-Value	Type
Pfam:MutS_II	1	127	3.3e-15	PFAM
MUTSd	158	485	9.4e-40	SMART
MUTSac	501	694	4.2e-84	SMART
Blast:MUTSac	702	760	5e-17	BLAST

Meta Mutation Damage Score

0.5961

Coding Region Coverage

1x: 99.4%
3x: 99.0%
10x: 97.8%
20x: 96.0%

Validation Efficiency

95% (81/85)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DNA mismatch repair mutS family. This member is a meiosis-specific protein that is not involved in DNA mismatch correction, but is required for reciprocal recombination and proper segregation of homologous chromosomes at meiosis I. This protein and MSH5 form a heterodimer which binds uniquely to a Holliday Junction and its developmental progenitor, thus provoking ADP-ATP exchange, and stabilizing the interaction between parental chromosomes during meiosis double-stranded break repair. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit male and female sterility associated with failure to undergo pairing during meiosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5730559C18Rik	T	C	1: 136,227,618	D83G	probably benign	Het
Acaa1a	T	A	9: 119,347,818		probably benign	Het
Adgrg7	T	A	16: 56,742,589	T462S	possibly damaging	Het
Akap6	A	T	12: 52,937,148	N825I	probably damaging	Het
Ankib1	T	A	5: 3,772,529	N59I	probably benign	Het
Anks6	T	C	4: 47,033,167	S633G	possibly damaging	Het
Ap4e1	C	A	2: 127,049,280	Y522*	probably null	Het
Art5	G	A	7: 102,097,957	T205I	probably damaging	Het
Ascc2	T	A	11: 4,649,855	L176H	probably damaging	Het
Atp13a5	T	C	16: 29,298,208	D529G	probably benign	Het
C2cd4a	T	C	9: 67,831,563	E66G	probably benign	Het
C8a	T	C	4: 104,856,492	D147G	probably damaging	Het
Ccdc109b	T	C	3: 129,918,726	M167V	probably benign	Het
Ccdc14	T	C	16: 34,721,649	V532A	possibly damaging	Het
Ccdc88a	T	A	11: 29,482,749		probably benign	Het
Cfap54	C	T	10: 92,885,096	E2543K	unknown	Het
Cldn13	C	T	5: 134,914,747	E195K	probably benign	Het
Cp	A	G	3: 19,971,082	S402G	probably null	Het
Cpa3	T	C	3: 20,225,194	T194A	probably benign	Het
Crygf	C	A	1: 65,927,997	Y93*	probably null	Het
Ctsh	A	G	9: 90,061,582	R87G	possibly damaging	Het
Cyp2t4	A	G	7: 27,158,246	D428G	possibly damaging	Het
Dnah17	C	G	11: 118,067,682		probably benign	Het
Dnah3	A	G	7: 119,967,905	V2366A	probably benign	Het
Dscaml1	A	T	9: 45,732,134	I1284F	probably benign	Het
Dsg1c	T	C	18: 20,272,346		probably benign	Het
Dst	G	T	1: 34,271,413	R4098L	probably damaging	Het
Efhb	A	G	17: 53,413,459		probably benign	Het
Epha7	A	T	4: 28,821,104	I90F	probably damaging	Het
Fam171a2	T	A	11: 102,437,881	D684V	probably damaging	Het
Fan1	A	G	7: 64,363,199	V665A	possibly damaging	Het
Fbn2	A	G	18: 58,037,747	C2191R	probably damaging	Het
Fkbp3	G	A	12: 65,073,918	A2V	probably benign	Het
G6pd2	A	G	5: 61,810,171	N430D	probably benign	Het
Gm13119	G	A	4: 144,363,782	C464Y	probably damaging	Het
Gm13547	T	A	2: 29,761,584	D7E	possibly damaging	Het
Hdac5	A	T	11: 102,205,812	D260E	probably damaging	Het
Hist1h4i	G	T	13: 22,041,027	Y99*	probably null	Het
Hsf2bp	T	C	17: 32,013,346	E142G	probably damaging	Het
Igf1r	C	T	7: 68,165,155	T268I	probably damaging	Het
Kcne3	C	T	7: 100,184,439	R88C	probably damaging	Het
Klk1b9	G	T	7: 43,979,372	G100V	possibly damaging	Het
Kmt2d	G	A	15: 98,853,581		probably benign	Het
Lama1	C	T	17: 67,752,368		probably benign	Het
Lcp2	C	T	11: 34,082,426	P335S	possibly damaging	Het
Lrrk2	T	A	15: 91,796,028	N2047K	probably damaging	Het
Mia2	T	C	12: 59,136,143	L36P	probably damaging	Het
Mmp13	G	A	9: 7,274,032	G169R	probably damaging	Het
Mmp13	A	T	9: 7,282,077	I460F	possibly damaging	Het
Msra	T	A	14: 64,210,532	M145L	probably benign	Het
Myo7a	A	T	7: 98,112,150		probably benign	Het
Nme8	A	T	13: 19,658,036	N422K	probably damaging	Het
Nol6	A	T	4: 41,121,115	F353I	probably damaging	Het
Nphp3	A	G	9: 104,018,274	K384E	probably damaging	Het
Olfr572	C	T	7: 102,928,604		probably null	Het
Olfr652	A	G	7: 104,564,337	I39V	probably benign	Het
Olfr672	A	G	7: 104,996,703	I67T	probably benign	Het
Phox2b	T	G	5: 67,096,214		probably benign	Het
Plec	A	T	15: 76,173,411	S4131T	probably damaging	Het
Pptc7	G	A	5: 122,313,591		probably benign	Het
Prpf40b	A	G	15: 99,316,289	E810G	probably benign	Het
Ptprc	C	T	1: 138,073,610	V965I	probably benign	Het
Pum1	T	A	4: 130,728,104	M180K	probably benign	Het
Ranbp3	T	C	17: 56,702,896		probably benign	Het
Rasgrf2	A	G	13: 91,972,274	S787P	probably benign	Het
Rnf19b	T	A	4: 129,073,551	N294K	probably damaging	Het
Samd3	A	T	10: 26,244,495	H156L	possibly damaging	Het
Serpinb6c	C	T	13: 33,880,031	R347Q	possibly damaging	Het
Slc36a3	A	G	11: 55,125,080	I416T	probably damaging	Het
Slc4a4	T	A	5: 89,129,641	F279Y	probably damaging	Het
Slc6a2	T	A	8: 92,992,801		probably benign	Het
Snrnp40	C	G	4: 130,378,043		probably null	Het
Tab2	A	G	10: 7,919,801	S232P	probably benign	Het
Tacc2	A	T	7: 130,625,595	K1356*	probably null	Het
Tmem87a	A	G	2: 120,359,542	S544P	probably damaging	Het
Trim52	T	A	14: 106,106,967	C20S	probably damaging	Het
Usp38	A	T	8: 81,014,150	V96E	probably benign	Het
Vmn2r59	T	C	7: 42,058,884	Y33C	probably damaging	Het
Vsig10l	T	G	7: 43,464,137	V171G	probably damaging	Het
Zfp957	T	A	14: 79,212,920	I480F	probably damaging	Het

Other mutations in Msh4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00862:Msh4	APN	3	153883735	missense	possibly damaging	0.88
IGL01098:Msh4	APN	3	153877982	splice site	probably benign
IGL01609:Msh4	APN	3	153897397	missense	probably damaging	1.00
IGL01785:Msh4	APN	3	153857507	missense	probably damaging	1.00
IGL01939:Msh4	APN	3	153857589	missense	probably damaging	1.00
IGL02022:Msh4	APN	3	153886956	missense	probably damaging	1.00
IGL02209:Msh4	APN	3	153888862	missense	probably damaging	1.00
IGL02224:Msh4	APN	3	153890185	missense	possibly damaging	0.94
IGL02240:Msh4	APN	3	153873674	missense	probably damaging	0.98
IGL02493:Msh4	APN	3	153877908	critical splice donor site	probably null
IGL02576:Msh4	APN	3	153867746	missense	probably damaging	1.00
IGL02616:Msh4	APN	3	153857523	missense	probably benign
IGL02812:Msh4	APN	3	153901400	splice site	probably benign
IGL02888:Msh4	APN	3	153896913	nonsense	probably null
IGL02992:Msh4	APN	3	153872325	missense	possibly damaging	0.79
IGL03191:Msh4	APN	3	153869608	missense	probably damaging	0.97
P0021:Msh4	UTSW	3	153888818	missense	probably damaging	1.00
R0057:Msh4	UTSW	3	153869681	missense	probably benign	0.16
R0057:Msh4	UTSW	3	153869681	missense	probably benign	0.16
R0368:Msh4	UTSW	3	153888825	missense	probably damaging	1.00
R0377:Msh4	UTSW	3	153896890	missense	probably benign	0.00
R0631:Msh4	UTSW	3	153866420	missense	probably benign	0.02
R0677:Msh4	UTSW	3	153879367	missense	possibly damaging	0.69
R0909:Msh4	UTSW	3	153863504	missense	probably benign	0.00
R1081:Msh4	UTSW	3	153872358	missense	probably benign	0.06
R1463:Msh4	UTSW	3	153857570	missense	probably damaging	1.00
R1476:Msh4	UTSW	3	153863384	missense	probably damaging	1.00
R1669:Msh4	UTSW	3	153876720	missense	possibly damaging	0.47
R1733:Msh4	UTSW	3	153867767	missense	probably damaging	1.00
R1859:Msh4	UTSW	3	153905880	missense	probably benign
R2168:Msh4	UTSW	3	153867835	nonsense	probably null
R2378:Msh4	UTSW	3	153863477	missense	probably damaging	0.99
R2991:Msh4	UTSW	3	153905860	missense	probably benign
R3025:Msh4	UTSW	3	153863491	missense	probably damaging	1.00
R4604:Msh4	UTSW	3	153872283	missense	probably damaging	1.00
R4757:Msh4	UTSW	3	153879387	missense	probably damaging	0.99
R5205:Msh4	UTSW	3	153866412	missense	probably damaging	1.00
R5285:Msh4	UTSW	3	153873713	missense	probably benign	0.03
R5766:Msh4	UTSW	3	153867840	missense	probably damaging	1.00
R5777:Msh4	UTSW	3	153863439	missense	probably benign	0.01
R5888:Msh4	UTSW	3	153867723	critical splice donor site	probably null
R7384:Msh4	UTSW	3	153888748	missense	probably benign	0.23
R7408:Msh4	UTSW	3	153876745	missense	probably benign	0.06
R7487:Msh4	UTSW	3	153863510	missense	probably damaging	1.00
R7503:Msh4	UTSW	3	153867750	missense	probably damaging	1.00
R7726:Msh4	UTSW	3	153866320	critical splice donor site	probably null
R7990:Msh4	UTSW	3	153896892	missense	probably damaging	1.00
R8097:Msh4	UTSW	3	153877908	critical splice donor site	probably null
R8805:Msh4	UTSW	3	153857633	missense	probably benign	0.00
R8814:Msh4	UTSW	3	153872320	missense	probably damaging	1.00
R8861:Msh4	UTSW	3	153901468	missense	probably benign	0.04
Z1177:Msh4	UTSW	3	153879368	missense	probably benign	0.00
Z1177:Msh4	UTSW	3	153901443	start gained	probably benign

Predicted Primers

PCR Primer
(F):5'- CAGACCAAGAGTACCCTGCCTCAT -3'
(R):5'- AAGCCCACAGATTATGTTGTCACAGTT -3'

Sequencing Primer
(F):5'- atctgcctgcctctgcc -3'
(R):5'- CAAAGGTAAGCTGTTTTTGCAAC -3'

Posted On

2013-07-11