Incidental Mutation 'R7747:Ncor2'
ID 596895
Institutional Source Beutler Lab
Gene Symbol Ncor2
Ensembl Gene ENSMUSG00000029478
Gene Name nuclear receptor co-repressor 2
Synonyms SMRTe, SMRT
MMRRC Submission 045803-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7747 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 125094217-125256283 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 125104102 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 996 (F996S)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055256] [ENSMUST00000086083] [ENSMUST00000111393] [ENSMUST00000111394] [ENSMUST00000111398] [ENSMUST00000111402] [ENSMUST00000134404] [ENSMUST00000138890]
AlphaFold Q9WU42
Predicted Effect probably damaging
Transcript: ENSMUST00000055256
AA Change: F1918S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000055954
Gene: ENSMUSG00000029478
AA Change: F1918S

DomainStartEndE-ValueType
low complexity region 147 154 N/A INTRINSIC
coiled coil region 167 207 N/A INTRINSIC
SANT 428 476 4.42e-6 SMART
coiled coil region 494 550 N/A INTRINSIC
SANT 607 655 1.43e-14 SMART
low complexity region 668 686 N/A INTRINSIC
low complexity region 699 726 N/A INTRINSIC
low complexity region 768 813 N/A INTRINSIC
low complexity region 822 828 N/A INTRINSIC
low complexity region 848 860 N/A INTRINSIC
low complexity region 867 874 N/A INTRINSIC
low complexity region 905 919 N/A INTRINSIC
low complexity region 935 944 N/A INTRINSIC
low complexity region 989 1000 N/A INTRINSIC
low complexity region 1011 1025 N/A INTRINSIC
low complexity region 1027 1043 N/A INTRINSIC
low complexity region 1086 1096 N/A INTRINSIC
low complexity region 1100 1116 N/A INTRINSIC
low complexity region 1366 1380 N/A INTRINSIC
low complexity region 1481 1497 N/A INTRINSIC
low complexity region 1616 1622 N/A INTRINSIC
low complexity region 1709 1726 N/A INTRINSIC
low complexity region 1737 1754 N/A INTRINSIC
low complexity region 1764 1776 N/A INTRINSIC
low complexity region 1800 1807 N/A INTRINSIC
low complexity region 1921 1939 N/A INTRINSIC
low complexity region 1959 1975 N/A INTRINSIC
low complexity region 2062 2076 N/A INTRINSIC
PDB:2GPV|I 2293 2314 8e-8 PDB
low complexity region 2324 2336 N/A INTRINSIC
low complexity region 2433 2453 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000086083
AA Change: F1913S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000083250
Gene: ENSMUSG00000029478
AA Change: F1913S

DomainStartEndE-ValueType
low complexity region 147 154 N/A INTRINSIC
coiled coil region 167 207 N/A INTRINSIC
SANT 428 476 4.42e-6 SMART
coiled coil region 494 550 N/A INTRINSIC
SANT 607 655 1.43e-14 SMART
low complexity region 668 686 N/A INTRINSIC
low complexity region 699 726 N/A INTRINSIC
low complexity region 768 813 N/A INTRINSIC
low complexity region 822 828 N/A INTRINSIC
low complexity region 848 860 N/A INTRINSIC
low complexity region 867 874 N/A INTRINSIC
low complexity region 905 919 N/A INTRINSIC
low complexity region 935 944 N/A INTRINSIC
low complexity region 988 999 N/A INTRINSIC
low complexity region 1010 1024 N/A INTRINSIC
low complexity region 1026 1042 N/A INTRINSIC
low complexity region 1085 1095 N/A INTRINSIC
low complexity region 1099 1115 N/A INTRINSIC
low complexity region 1364 1378 N/A INTRINSIC
low complexity region 1479 1495 N/A INTRINSIC
low complexity region 1614 1620 N/A INTRINSIC
low complexity region 1707 1724 N/A INTRINSIC
low complexity region 1735 1752 N/A INTRINSIC
low complexity region 1762 1774 N/A INTRINSIC
low complexity region 1798 1805 N/A INTRINSIC
low complexity region 1916 1934 N/A INTRINSIC
low complexity region 1954 1970 N/A INTRINSIC
low complexity region 2057 2071 N/A INTRINSIC
PDB:2GPV|I 2288 2309 8e-8 PDB
low complexity region 2319 2331 N/A INTRINSIC
low complexity region 2428 2448 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111393
AA Change: F1777S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107024
Gene: ENSMUSG00000029478
AA Change: F1777S

DomainStartEndE-ValueType
coiled coil region 1 32 N/A INTRINSIC
SANT 253 301 4.42e-6 SMART
coiled coil region 319 375 N/A INTRINSIC
SANT 432 480 1.43e-14 SMART
low complexity region 493 511 N/A INTRINSIC
low complexity region 524 551 N/A INTRINSIC
low complexity region 593 638 N/A INTRINSIC
low complexity region 647 653 N/A INTRINSIC
low complexity region 673 685 N/A INTRINSIC
low complexity region 692 699 N/A INTRINSIC
low complexity region 730 744 N/A INTRINSIC
low complexity region 760 769 N/A INTRINSIC
low complexity region 813 824 N/A INTRINSIC
low complexity region 835 849 N/A INTRINSIC
low complexity region 851 867 N/A INTRINSIC
low complexity region 910 920 N/A INTRINSIC
low complexity region 924 940 N/A INTRINSIC
low complexity region 1225 1239 N/A INTRINSIC
low complexity region 1340 1356 N/A INTRINSIC
low complexity region 1475 1481 N/A INTRINSIC
low complexity region 1568 1585 N/A INTRINSIC
low complexity region 1596 1613 N/A INTRINSIC
low complexity region 1623 1635 N/A INTRINSIC
low complexity region 1659 1666 N/A INTRINSIC
low complexity region 1780 1798 N/A INTRINSIC
low complexity region 1818 1834 N/A INTRINSIC
low complexity region 1921 1935 N/A INTRINSIC
PDB:2GPV|I 2152 2173 7e-8 PDB
low complexity region 2183 2195 N/A INTRINSIC
low complexity region 2292 2312 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111394
AA Change: F1698S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107025
Gene: ENSMUSG00000029478
AA Change: F1698S

DomainStartEndE-ValueType
SANT 209 257 4.42e-6 SMART
coiled coil region 275 331 N/A INTRINSIC
SANT 388 436 1.43e-14 SMART
low complexity region 449 467 N/A INTRINSIC
low complexity region 480 507 N/A INTRINSIC
low complexity region 549 594 N/A INTRINSIC
low complexity region 603 609 N/A INTRINSIC
low complexity region 629 641 N/A INTRINSIC
low complexity region 648 655 N/A INTRINSIC
low complexity region 686 700 N/A INTRINSIC
low complexity region 716 725 N/A INTRINSIC
low complexity region 769 780 N/A INTRINSIC
low complexity region 791 805 N/A INTRINSIC
low complexity region 807 823 N/A INTRINSIC
low complexity region 866 876 N/A INTRINSIC
low complexity region 880 896 N/A INTRINSIC
low complexity region 1146 1160 N/A INTRINSIC
low complexity region 1261 1277 N/A INTRINSIC
low complexity region 1396 1402 N/A INTRINSIC
low complexity region 1489 1506 N/A INTRINSIC
low complexity region 1517 1534 N/A INTRINSIC
low complexity region 1544 1556 N/A INTRINSIC
low complexity region 1580 1587 N/A INTRINSIC
low complexity region 1701 1719 N/A INTRINSIC
low complexity region 1739 1755 N/A INTRINSIC
low complexity region 1842 1856 N/A INTRINSIC
PDB:2GPV|I 2073 2094 7e-8 PDB
low complexity region 2104 2116 N/A INTRINSIC
low complexity region 2213 2233 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111398
AA Change: F1917S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107029
Gene: ENSMUSG00000029478
AA Change: F1917S

DomainStartEndE-ValueType
low complexity region 147 154 N/A INTRINSIC
coiled coil region 167 207 N/A INTRINSIC
SANT 428 476 4.42e-6 SMART
coiled coil region 494 550 N/A INTRINSIC
SANT 607 655 1.43e-14 SMART
low complexity region 668 686 N/A INTRINSIC
low complexity region 699 726 N/A INTRINSIC
low complexity region 768 813 N/A INTRINSIC
low complexity region 822 828 N/A INTRINSIC
low complexity region 848 860 N/A INTRINSIC
low complexity region 867 874 N/A INTRINSIC
low complexity region 905 919 N/A INTRINSIC
low complexity region 935 944 N/A INTRINSIC
low complexity region 988 999 N/A INTRINSIC
low complexity region 1010 1024 N/A INTRINSIC
low complexity region 1026 1042 N/A INTRINSIC
low complexity region 1085 1095 N/A INTRINSIC
low complexity region 1099 1115 N/A INTRINSIC
low complexity region 1365 1379 N/A INTRINSIC
low complexity region 1480 1496 N/A INTRINSIC
low complexity region 1615 1621 N/A INTRINSIC
low complexity region 1708 1725 N/A INTRINSIC
low complexity region 1736 1753 N/A INTRINSIC
low complexity region 1763 1775 N/A INTRINSIC
low complexity region 1799 1806 N/A INTRINSIC
low complexity region 1920 1938 N/A INTRINSIC
low complexity region 1958 1974 N/A INTRINSIC
low complexity region 2061 2075 N/A INTRINSIC
PDB:2GPV|I 2292 2313 8e-8 PDB
low complexity region 2323 2335 N/A INTRINSIC
low complexity region 2432 2452 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111402
AA Change: F1952S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107033
Gene: ENSMUSG00000029478
AA Change: F1952S

DomainStartEndE-ValueType
Pfam:GPS2_interact 141 229 4.9e-41 PFAM
SANT 428 476 4.42e-6 SMART
coiled coil region 494 550 N/A INTRINSIC
SANT 607 655 1.43e-14 SMART
low complexity region 668 686 N/A INTRINSIC
low complexity region 699 726 N/A INTRINSIC
low complexity region 768 813 N/A INTRINSIC
low complexity region 822 828 N/A INTRINSIC
low complexity region 848 860 N/A INTRINSIC
low complexity region 867 874 N/A INTRINSIC
low complexity region 905 919 N/A INTRINSIC
low complexity region 935 944 N/A INTRINSIC
low complexity region 988 999 N/A INTRINSIC
low complexity region 1010 1024 N/A INTRINSIC
low complexity region 1026 1042 N/A INTRINSIC
low complexity region 1085 1095 N/A INTRINSIC
low complexity region 1099 1115 N/A INTRINSIC
low complexity region 1400 1414 N/A INTRINSIC
low complexity region 1515 1531 N/A INTRINSIC
low complexity region 1650 1656 N/A INTRINSIC
low complexity region 1743 1760 N/A INTRINSIC
low complexity region 1771 1788 N/A INTRINSIC
low complexity region 1798 1810 N/A INTRINSIC
low complexity region 1834 1841 N/A INTRINSIC
low complexity region 1955 1973 N/A INTRINSIC
low complexity region 1993 2009 N/A INTRINSIC
low complexity region 2096 2110 N/A INTRINSIC
PDB:2GPV|I 2327 2348 8e-8 PDB
low complexity region 2358 2370 N/A INTRINSIC
low complexity region 2467 2487 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000117098
Gene: ENSMUSG00000029478
AA Change: F996S

DomainStartEndE-ValueType
low complexity region 36 47 N/A INTRINSIC
low complexity region 58 72 N/A INTRINSIC
low complexity region 74 90 N/A INTRINSIC
low complexity region 133 143 N/A INTRINSIC
low complexity region 147 163 N/A INTRINSIC
low complexity region 448 462 N/A INTRINSIC
low complexity region 563 579 N/A INTRINSIC
low complexity region 698 704 N/A INTRINSIC
low complexity region 791 808 N/A INTRINSIC
low complexity region 819 836 N/A INTRINSIC
low complexity region 846 858 N/A INTRINSIC
low complexity region 882 889 N/A INTRINSIC
low complexity region 1000 1018 N/A INTRINSIC
low complexity region 1038 1054 N/A INTRINSIC
low complexity region 1141 1155 N/A INTRINSIC
PDB:2GPV|I 1372 1393 5e-8 PDB
low complexity region 1403 1415 N/A INTRINSIC
low complexity region 1512 1532 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134404
SMART Domains Protein: ENSMUSP00000121588
Gene: ENSMUSG00000029478

DomainStartEndE-ValueType
SANT 2 49 1.94e-2 SMART
low complexity region 84 100 N/A INTRINSIC
low complexity region 113 140 N/A INTRINSIC
low complexity region 182 227 N/A INTRINSIC
low complexity region 236 242 N/A INTRINSIC
low complexity region 262 274 N/A INTRINSIC
low complexity region 281 288 N/A INTRINSIC
low complexity region 319 333 N/A INTRINSIC
low complexity region 349 358 N/A INTRINSIC
low complexity region 402 413 N/A INTRINSIC
low complexity region 424 438 N/A INTRINSIC
low complexity region 440 456 N/A INTRINSIC
low complexity region 499 509 N/A INTRINSIC
low complexity region 513 529 N/A INTRINSIC
low complexity region 813 827 N/A INTRINSIC
low complexity region 928 944 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134819
SMART Domains Protein: ENSMUSP00000115776
Gene: ENSMUSG00000029478

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
low complexity region 145 159 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138890
SMART Domains Protein: ENSMUSP00000117813
Gene: ENSMUSG00000029478

DomainStartEndE-ValueType
low complexity region 178 186 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200297
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (89/89)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear receptor co-repressor that mediates transcriptional silencing of certain target genes. The encoded protein is a member of a family of thyroid hormone- and retinoic acid receptor-associated co-repressors. This protein acts as part of a multisubunit complex which includes histone deacetylases to modify chromatin structure that prevents basal transcriptional activity of target genes. Aberrant expression of this gene is associated with certain cancers. Alternate splicing results in multiple transcript variants encoding different isoforms.[provided by RefSeq, Apr 2011]
PHENOTYPE: Mice homozygous for a null allele die before E16.5 of heart defects and exhibit neural defects. [provided by MGI curators]
Allele List at MGI

All alleles(145) : Targeted(2) Gene trapped(143)

Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010109A12Rik G A 5: 93,354,416 (GRCm39) probably null Het
2410004P03Rik C T 12: 17,057,149 (GRCm39) S116N probably damaging Het
3425401B19Rik T C 14: 32,385,026 (GRCm39) D313G possibly damaging Het
AA986860 A G 1: 130,671,284 (GRCm39) E502G possibly damaging Het
Adamts20 T A 15: 94,189,468 (GRCm39) K1462* probably null Het
Adgrg6 A C 10: 14,326,321 (GRCm39) probably null Het
Ankrd13d G A 19: 4,331,013 (GRCm39) H165Y probably damaging Het
Arap3 T C 18: 38,121,941 (GRCm39) probably null Het
Arhgap33 A G 7: 30,223,560 (GRCm39) V823A probably damaging Het
Aup1 C A 6: 83,031,776 (GRCm39) P34T unknown Het
Bcl2l2 C T 14: 55,121,836 (GRCm39) probably benign Het
Bicc1 T C 10: 70,782,823 (GRCm39) T515A probably benign Het
Ccdc73 A C 2: 104,759,901 (GRCm39) K106Q probably damaging Het
Celsr3 G A 9: 108,707,177 (GRCm39) R1220Q possibly damaging Het
Cep290 C T 10: 100,394,038 (GRCm39) Q2082* probably null Het
Cercam A G 2: 29,761,298 (GRCm39) D104G probably benign Het
Champ1 A G 8: 13,929,990 (GRCm39) H716R probably damaging Het
Cntrl A T 2: 35,006,810 (GRCm39) I159F probably damaging Het
Col11a1 T C 3: 113,896,221 (GRCm39) I507T unknown Het
Cped1 T C 6: 22,143,973 (GRCm39) I573T probably damaging Het
Crot C T 5: 9,018,869 (GRCm39) probably null Het
D1Pas1 T A 1: 186,700,874 (GRCm39) S268T probably benign Het
Efcab3 T G 11: 104,733,429 (GRCm39) I2011S probably damaging Het
Erich6 A G 3: 58,526,349 (GRCm39) V551A probably damaging Het
Fbxo32 T C 15: 58,054,757 (GRCm39) N192S probably damaging Het
Fgd6 T C 10: 93,880,778 (GRCm39) V544A probably damaging Het
Fnbp1 C T 2: 30,926,159 (GRCm39) G552E probably damaging Het
Gjb5 A T 4: 127,249,955 (GRCm39) V63D probably damaging Het
Gm10053 T C 19: 24,853,403 (GRCm39) I96T probably benign Het
Gm38119 T C 3: 92,645,328 (GRCm39) S89G unknown Het
Gpn2 A G 4: 133,313,356 (GRCm39) I183V probably benign Het
Greb1 C T 12: 16,724,796 (GRCm39) V1793M probably benign Het
H2-Q7 A G 17: 35,659,037 (GRCm39) I163V probably benign Het
Hrh2 T C 13: 54,368,549 (GRCm39) V175A possibly damaging Het
Hsd3b3 C T 3: 98,651,214 (GRCm39) V79I possibly damaging Het
Itgb7 T C 15: 102,125,039 (GRCm39) I727M possibly damaging Het
Kcnj16 T A 11: 110,915,569 (GRCm39) F77Y probably damaging Het
Lilra6 T A 7: 3,915,995 (GRCm39) Q288L probably benign Het
Lrrc37 A T 11: 103,505,081 (GRCm39) S2296T probably damaging Het
Malrd1 G A 2: 16,079,646 (GRCm39) V1788M unknown Het
Mau2 T C 8: 70,479,373 (GRCm39) I349V possibly damaging Het
Mbnl3 C T X: 50,219,211 (GRCm39) R181H probably damaging Het
Mfsd6 T C 1: 52,715,706 (GRCm39) T524A probably benign Het
Mical2 G T 7: 111,933,046 (GRCm39) R740L probably benign Het
Mknk1 G A 4: 115,735,269 (GRCm39) C379Y possibly damaging Het
Mta3 A T 17: 84,099,165 (GRCm39) K410* probably null Het
Myb A C 10: 21,032,324 (GRCm39) I19S possibly damaging Het
Nlrp1a T C 11: 71,014,234 (GRCm39) M339V possibly damaging Het
Or2n1d C T 17: 38,646,285 (GRCm39) P79L probably benign Het
Or56b35 A G 7: 104,963,654 (GRCm39) K148E probably damaging Het
Pcdhga5 C T 18: 37,829,835 (GRCm39) T761I possibly damaging Het
Pcmtd2 T C 2: 181,493,452 (GRCm39) L219P possibly damaging Het
Pfdn1 C T 18: 36,565,358 (GRCm39) probably null Het
Pkn3 G A 2: 29,980,596 (GRCm39) C829Y probably benign Het
Pld1 T C 3: 28,141,338 (GRCm39) S634P possibly damaging Het
Pofut2 T G 10: 77,098,304 (GRCm39) V139G possibly damaging Het
Prdm12 C A 2: 31,543,883 (GRCm39) probably null Het
Prkar2b C A 12: 32,110,937 (GRCm39) A49S probably benign Het
Prmt1 A T 7: 44,633,560 (GRCm39) probably null Het
Rab39 A T 9: 53,597,700 (GRCm39) D188E probably benign Het
Repin1 G T 6: 48,574,279 (GRCm39) E403* probably null Het
Scgb1b19 A G 7: 32,986,923 (GRCm39) I25V probably benign Het
Scn9a A T 2: 66,314,642 (GRCm39) I1692N probably damaging Het
Sdk1 G T 5: 142,070,246 (GRCm39) G1137V probably damaging Het
Sec16b A G 1: 157,393,042 (GRCm39) T950A possibly damaging Het
Senp2 G T 16: 21,857,372 (GRCm39) R398L probably damaging Het
Sfswap G T 5: 129,627,657 (GRCm39) probably null Het
Sh3rf1 A G 8: 61,806,787 (GRCm39) T362A probably damaging Het
Slc17a1 A T 13: 24,072,035 (GRCm39) I418F probably benign Het
Slc1a4 A T 11: 20,258,587 (GRCm39) M284K probably damaging Het
Slc5a2 A T 7: 127,865,567 (GRCm39) probably null Het
Slco5a1 A G 1: 13,060,346 (GRCm39) V125A probably benign Het
Smu1 A G 4: 40,748,600 (GRCm39) V230A probably benign Het
Sp4 A G 12: 118,218,139 (GRCm39) probably null Het
Stbd1 A G 5: 92,753,416 (GRCm39) K302R probably damaging Het
Stx2 A T 5: 129,063,481 (GRCm39) V268D probably benign Het
Tbc1d9b G A 11: 50,052,447 (GRCm39) A885T probably benign Het
Tbce T A 13: 14,181,063 (GRCm39) D267V possibly damaging Het
Tert T C 13: 73,775,725 (GRCm39) Y159H probably damaging Het
Thbs2 T A 17: 14,890,301 (GRCm39) I1102F possibly damaging Het
Tmprss7 G C 16: 45,503,873 (GRCm39) A183G probably benign Het
Top3b C A 16: 16,705,585 (GRCm39) P450Q probably benign Het
Trpm6 A T 19: 18,727,409 (GRCm39) probably null Het
Ube4a T C 9: 44,837,271 (GRCm39) D988G probably damaging Het
Vmn1r158 A T 7: 22,489,725 (GRCm39) S161R probably benign Het
Vps41 T C 13: 19,025,422 (GRCm39) probably null Het
Zfp354c TCACACTCGGCACA TCACA 11: 50,706,067 (GRCm39) probably benign Het
Zfp617 T A 8: 72,682,033 (GRCm39) probably null Het
Zfp808 C T 13: 62,319,319 (GRCm39) H183Y probably benign Het
Zfy1 A T Y: 725,496 (GRCm39) C756* probably null Het
Zswim2 A T 2: 83,745,951 (GRCm39) Y496N probably damaging Het
Other mutations in Ncor2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00330:Ncor2 APN 5 125,119,807 (GRCm39) critical splice donor site probably null
IGL00519:Ncor2 APN 5 125,161,988 (GRCm39) missense unknown
IGL00900:Ncor2 APN 5 125,102,848 (GRCm39) missense probably damaging 1.00
IGL00950:Ncor2 APN 5 125,163,954 (GRCm39) missense unknown
IGL01320:Ncor2 APN 5 125,186,991 (GRCm39) missense probably benign 0.00
IGL01382:Ncor2 APN 5 125,132,837 (GRCm39) missense probably damaging 0.96
IGL01573:Ncor2 APN 5 125,162,090 (GRCm39) missense unknown
IGL01721:Ncor2 APN 5 125,128,001 (GRCm39) missense probably damaging 1.00
IGL01875:Ncor2 APN 5 125,142,934 (GRCm39) missense unknown
IGL02090:Ncor2 APN 5 125,111,467 (GRCm39) missense probably damaging 0.99
IGL02192:Ncor2 APN 5 125,101,301 (GRCm39) missense probably damaging 1.00
IGL02396:Ncor2 APN 5 125,114,978 (GRCm39) missense probably damaging 1.00
IGL02934:Ncor2 APN 5 125,102,621 (GRCm39) missense probably benign 0.33
IGL02997:Ncor2 APN 5 125,196,634 (GRCm39) intron probably benign
R0019:Ncor2 UTSW 5 125,196,545 (GRCm39) critical splice donor site probably null
R0331:Ncor2 UTSW 5 125,161,981 (GRCm39) missense unknown
R0333:Ncor2 UTSW 5 125,111,408 (GRCm39) splice site probably benign
R0403:Ncor2 UTSW 5 125,110,401 (GRCm39) missense possibly damaging 0.73
R0557:Ncor2 UTSW 5 125,183,369 (GRCm39) nonsense probably null
R0562:Ncor2 UTSW 5 125,162,093 (GRCm39) missense unknown
R0671:Ncor2 UTSW 5 125,126,451 (GRCm39) missense probably benign 0.13
R0699:Ncor2 UTSW 5 125,106,176 (GRCm39) unclassified probably benign
R0865:Ncor2 UTSW 5 125,116,046 (GRCm39) missense probably benign 0.17
R1183:Ncor2 UTSW 5 125,100,585 (GRCm39) missense possibly damaging 0.65
R1325:Ncor2 UTSW 5 125,195,844 (GRCm39) intron probably benign
R1344:Ncor2 UTSW 5 125,102,510 (GRCm39) missense probably damaging 1.00
R1433:Ncor2 UTSW 5 125,187,039 (GRCm39) intron probably benign
R1481:Ncor2 UTSW 5 125,104,202 (GRCm39) nonsense probably null
R1539:Ncor2 UTSW 5 125,187,003 (GRCm39) missense probably benign 0.07
R1558:Ncor2 UTSW 5 125,110,610 (GRCm39) missense probably damaging 1.00
R1585:Ncor2 UTSW 5 125,162,062 (GRCm39) missense unknown
R1611:Ncor2 UTSW 5 125,187,084 (GRCm39) intron probably benign
R1764:Ncor2 UTSW 5 125,105,679 (GRCm39) missense possibly damaging 0.91
R1789:Ncor2 UTSW 5 125,096,954 (GRCm39) missense probably damaging 1.00
R1809:Ncor2 UTSW 5 125,195,857 (GRCm39) intron probably benign
R1901:Ncor2 UTSW 5 125,102,489 (GRCm39) missense probably benign 0.39
R1946:Ncor2 UTSW 5 125,111,476 (GRCm39) missense probably damaging 1.00
R1970:Ncor2 UTSW 5 125,115,982 (GRCm39) missense probably damaging 0.99
R2048:Ncor2 UTSW 5 125,161,996 (GRCm39) missense unknown
R2137:Ncor2 UTSW 5 125,107,776 (GRCm39) missense probably damaging 1.00
R2270:Ncor2 UTSW 5 125,115,019 (GRCm39) missense probably benign 0.33
R2380:Ncor2 UTSW 5 125,113,144 (GRCm39) missense possibly damaging 0.89
R2570:Ncor2 UTSW 5 125,105,864 (GRCm39) critical splice acceptor site probably null
R2918:Ncor2 UTSW 5 125,102,824 (GRCm39) missense probably damaging 0.99
R2921:Ncor2 UTSW 5 125,132,855 (GRCm39) missense probably damaging 1.00
R2922:Ncor2 UTSW 5 125,132,855 (GRCm39) missense probably damaging 1.00
R2923:Ncor2 UTSW 5 125,132,855 (GRCm39) missense probably damaging 1.00
R3116:Ncor2 UTSW 5 125,101,230 (GRCm39) missense probably damaging 1.00
R3768:Ncor2 UTSW 5 125,105,751 (GRCm39) missense probably damaging 1.00
R3826:Ncor2 UTSW 5 125,195,756 (GRCm39) intron probably benign
R3829:Ncor2 UTSW 5 125,195,756 (GRCm39) intron probably benign
R3830:Ncor2 UTSW 5 125,195,756 (GRCm39) intron probably benign
R3951:Ncor2 UTSW 5 125,109,320 (GRCm39) missense possibly damaging 0.94
R4175:Ncor2 UTSW 5 125,128,020 (GRCm39) missense probably damaging 0.99
R4360:Ncor2 UTSW 5 125,106,036 (GRCm39) missense probably damaging 1.00
R4470:Ncor2 UTSW 5 125,179,705 (GRCm39) critical splice donor site probably null
R4490:Ncor2 UTSW 5 125,113,879 (GRCm39) splice site probably null
R4573:Ncor2 UTSW 5 125,132,889 (GRCm39) missense probably damaging 0.99
R4611:Ncor2 UTSW 5 125,107,923 (GRCm39) missense probably damaging 1.00
R4799:Ncor2 UTSW 5 125,114,124 (GRCm39) critical splice donor site probably null
R4851:Ncor2 UTSW 5 125,110,431 (GRCm39) missense possibly damaging 0.93
R4853:Ncor2 UTSW 5 125,158,247 (GRCm39) missense unknown
R4853:Ncor2 UTSW 5 125,102,169 (GRCm39) missense probably damaging 0.99
R4896:Ncor2 UTSW 5 125,126,404 (GRCm39) critical splice donor site probably null
R4997:Ncor2 UTSW 5 125,111,074 (GRCm39) missense probably damaging 0.99
R5057:Ncor2 UTSW 5 125,125,130 (GRCm39) missense possibly damaging 0.86
R5253:Ncor2 UTSW 5 125,103,994 (GRCm39) missense probably benign 0.44
R5461:Ncor2 UTSW 5 125,104,177 (GRCm39) missense probably damaging 1.00
R5585:Ncor2 UTSW 5 125,144,975 (GRCm39) nonsense probably null
R5638:Ncor2 UTSW 5 125,125,364 (GRCm39) missense probably benign 0.33
R5879:Ncor2 UTSW 5 125,103,839 (GRCm39) unclassified probably benign
R5967:Ncor2 UTSW 5 125,146,048 (GRCm39) missense unknown
R5999:Ncor2 UTSW 5 125,110,505 (GRCm39) missense probably damaging 1.00
R6020:Ncor2 UTSW 5 125,097,075 (GRCm39) missense probably benign 0.14
R6109:Ncor2 UTSW 5 125,132,910 (GRCm39) missense probably damaging 1.00
R6423:Ncor2 UTSW 5 125,164,966 (GRCm39) missense unknown
R6462:Ncor2 UTSW 5 125,101,236 (GRCm39) missense probably damaging 1.00
R6478:Ncor2 UTSW 5 125,187,069 (GRCm39) intron probably benign
R7074:Ncor2 UTSW 5 125,126,430 (GRCm39) nonsense probably null
R7179:Ncor2 UTSW 5 125,132,847 (GRCm39) missense unknown
R7261:Ncor2 UTSW 5 125,187,143 (GRCm39) splice site probably null
R7263:Ncor2 UTSW 5 125,109,196 (GRCm39) missense
R7273:Ncor2 UTSW 5 125,100,687 (GRCm39) missense
R7282:Ncor2 UTSW 5 125,097,104 (GRCm39) missense
R7570:Ncor2 UTSW 5 125,107,153 (GRCm39) missense
R7725:Ncor2 UTSW 5 125,100,630 (GRCm39) missense
R7748:Ncor2 UTSW 5 125,187,031 (GRCm39) missense unknown
R7825:Ncor2 UTSW 5 125,114,141 (GRCm39) missense possibly damaging 0.53
R8008:Ncor2 UTSW 5 125,144,983 (GRCm39) missense unknown
R8126:Ncor2 UTSW 5 125,183,268 (GRCm39) missense unknown
R8137:Ncor2 UTSW 5 125,114,957 (GRCm39) missense
R8706:Ncor2 UTSW 5 125,145,010 (GRCm39) missense unknown
R8751:Ncor2 UTSW 5 125,115,964 (GRCm39) missense
R8819:Ncor2 UTSW 5 125,106,291 (GRCm39) missense
R8820:Ncor2 UTSW 5 125,106,291 (GRCm39) missense
R8824:Ncor2 UTSW 5 125,195,821 (GRCm39) missense
R8867:Ncor2 UTSW 5 125,179,739 (GRCm39) missense unknown
R8919:Ncor2 UTSW 5 125,106,253 (GRCm39) missense
R8922:Ncor2 UTSW 5 125,163,939 (GRCm39) missense unknown
R9076:Ncor2 UTSW 5 125,111,086 (GRCm39) missense
R9249:Ncor2 UTSW 5 125,186,988 (GRCm39) missense unknown
R9276:Ncor2 UTSW 5 125,113,150 (GRCm39) missense
R9362:Ncor2 UTSW 5 125,095,265 (GRCm39) missense
R9667:Ncor2 UTSW 5 125,125,545 (GRCm39) missense unknown
R9684:Ncor2 UTSW 5 125,102,139 (GRCm39) missense
Z1088:Ncor2 UTSW 5 125,163,904 (GRCm39) critical splice donor site probably null
Z1088:Ncor2 UTSW 5 125,144,852 (GRCm39) missense unknown
Z1177:Ncor2 UTSW 5 125,113,913 (GRCm39) missense
Z1177:Ncor2 UTSW 5 125,125,058 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTTCTCGGTGCAGATCTGAG -3'
(R):5'- TGTGAGGTAGGAAGCCATTG -3'

Sequencing Primer
(F):5'- TGCAGATCTGAGGCCGAG -3'
(R):5'- ATTGGCCAGCACTGCCTG -3'
Posted On 2019-11-26